1,721,435 research outputs found
DESAIN PRIMER PCR SECARA IN SILICO UNTUK AMPLIFIKASI GEN COI PADA KUPU-KUPU Papilio ulysses Linnaeus DARI PULAU BACAN
Full text linkThe insillico research was conducted to produce primer sequence of COI gene in Butterfly species Papilio ulyses from Bacan Island that will be used in gene isolation. The COI sub-unit I is a barcode gene that generally have special purposes in animal identification. It is also available in phyilogenetic analysis. The first step of method is downloading the COI DNA sequence of Papilio ulysses from GeneBank (NCBI). Then the conserve region of COI sequence is identified to determine primer. Primer is designed with primer designer software (Genamics Expression) in two direction of DNA reading frame that are : forward primer (COI Pu-F) and reverse primer (COI Pu-R). The last step is primer confirmation with primer blast tool in NCBI. Primers of COI gene that are produced consist of two, that are CGAAAATGACTTTATTCAACA for forward primer (COI Pu-R) and AGCAGTAATTCCAACAGCTC for reverse primer (COI Pu-R). The optimal temperature of annealing is from 50,740 to 55,740 Celsius with PCR product around 567 base pair long. Key Words : PCR primer, in silico, COI gene, Papilio ulysses, Bacan island
PENGARUH STRATEGI PEMASARAN DAN PELAYANAN PERGURUAN TINGGI TERHADAP KEPUASAN PELANGGAN PROGRAM UNGGULAN STRATA SATU (S1) SEKOLAH TINGGI ILMU ADMINISTRASI MANDALA INDONESIA (STIAMI)
Full text linkThis study aims to determine the Effects of Marketing Strategies and Customer Satisfaction Quality Of Service / Student. Samples are 32 respondents drawn from a population of 36 students with Saturated sampling method. Data collection using questionnaire techniques, engineering research questionnaires, and observation. Processing of primary data using Analytical Methods Descriptive Analysis Method. From the discussion following results were obtained:First, There is the influence of Marketing (X1) on Customer Satisfaction / Student (Y) . Marketing significant value in the variable is equal to 0.966 (<0.05) which means that there is no influence of marketing variables partially on Customer Satisfaction. So H0 is rejected H1 is accepted. There is the influence of Quality of Service (X2) are positive and significant impact on Customer Satisfaction / Student (Y) . The value of significance in the variable quality of service is equal to 0.000 (< 0.01), which means with a confidence level of 99 percent variable partial Service Quality Customer Satisfaction is very real influence . So H0 H1 is rejected. There is positive and significant, Marketing Variables (X1) and Quality of Service (X2) jointly against Employee Morale (Y). Through the significance test using the F distribution, obtained Significance calculated F of 0.000 ( < 0.05 ) . This means that H0 is accepted or rejected H1. And the value of the coefficient of determination obtained with SPSS calculation amounted to 0.718. This indicates that 71.8 % of this value indicates that the total variation influences all independent variables to variable Quality Customer / Students. The influence of other variables beyond the variables studied was 28.2 percent. variables beyond the variables studied was 28.2 percent .Secondly, Strategy Marketing and Service Quality, both individually and jointly influence on customer satisfaction / student
RETRACTED: Implementation of reversible jump MCMC algorithm to segment the piecewise Polynomial Regression
Full text linkRETRACTED
Following a rigorous, carefully concerns and considered review of the article published in International Journal of Advances in Intelligent Informatics to article entitled “Implementation of reversible jump MCMC algorithm to segment the piecewise Polynomial Regression” Vol 2, No 2, pp. 88-93, July 2016, DOI: http://dx.doi.org/10.26555/ijain.v2i2.62.
This paper has been found to be in violation of the International Journal of Advances in Intelligent Informatics Publication principles and has been retracted.
The article contained redundant material, the editor investigated and found that the paper published in International Journal of Mathematical, Computational, Physical, Electrical and Computer Engineering, Vol. 10, No. 5 (2016), pp. 232-235, URL: http://scholar.waset.org/1999.7/10004307, entitled "Segmentation of Piecewise Polynomial Regression Model by Using Reversible Jump MCMC Algorithm".
The document and its content has been removed from International Journal of Advances in Intelligent Informatics, and reasonable effort should be made to remove all references to this article
Gender Development And Empowerment Effect On Income Inequality And Poverty
Full text linkThis research aims to know the impact of development and gender empowerment on the condition of income inequality and poverty in Indonesia. This study uses data on the gender development index (IPG), gender empowerment index (IDG), income inequality or Gini ratio/GR), and the number of poor people (POV) according to data from 34 provinces in Indonesia for the period 2015-2020. The analytical method used is the Granger causality test and panel regression model (common effect model/CEM, fixed effect model/FEM), random effect model/REM). The analysis results found that the gender development index (GIP) had a positive and significant effect on the number of poor people (POV) in Indonesia
Persepsi Orang Tua dan Siswa dalam Pembelajaran Jarak Jauh Teknik Blended Learning
Full text linkTujuan penelitian yang ingin dicapai dalam penelitian ini yaitu untuk mengetahui Persepsi Orang tua dan Siswa dalam Pembelajaran Jarak Jauh Teknik Blended learning; Studi Kasus di SD Negeri Kecamatan Batin XXIV Kabupaten Batanghari. Penelitian ini mengunakan pendekatan deskriptif kualitatif, metode penelitian yang digunakan dengan cara wawancara. Dari hasil wawancara yang telah dilakukan didapat hasil bahwa sebagian besar orang tua dan juga siswa tidak setuju dengan adanya pembelajaran secara Blended learning terutama pada saat daring, karena dianggap belum efektif dan juga banyak menemui kendala dalam proses pembelajaran daring yang dilakukan, namun orang tua siswa tetap mendukung kebijakan ini karena pembelajaran daring ini menjadi solusi yang tepat saat masa pandemi seperti sekarang, walaupun belum dapat dilaksanakan secara maksimal. Kesimpulan yang didapat dari penelitian ini adalah bahwa sebagian besar orang tua dan siswa kurang setuju dengan pembelajaran teknik blended learning khususnya pada saat daring, dan siswa terkendala jaringan internet yang tidak stabil, sulit memahami beberapa materi khusunya matematika, serta peran orang tua dalam mendampingi siswa belajar daring yang kurang maksimal.
Kata kunci : Persepsi, Blended learnin
Systematic Mapping Of Earning Management Topics For 2017 – 2023 Based On Bibliometric Analysis
Full text linkThis research uses bibliometric analysis to produce a comprehensive mapping of Profit Management research. This research examines changes in citations, publication trends, author collaborations, trending titles, trending author keywords, trending abstracts, countries, dominating factors, research developments, and future research on Profit Management papers from the Scopus index for the year 2017 - 2023. This research uses bibliometric analysis methods. The research sample used was 1,035 articles with the keyword "Profit Management". The articles used are sourced from Scopus indexed journals for 2017-2024, with the help of Publish or Perish (PoP). This bibliometric analysis uses VOSviewer (VV). The year with the most citations, according to statistics, was 2017, with 1,440 citations. Jennings Mayo-Wilson, Larissa are the authors with the most networks/collaborations, as many as 85. The term "earnings management" is the keyword most commonly used in earnings management articles. Ten countries linked earnings management to this research: Vietnam, China, Ethiopia, Pakistan, Thailand, Malaysia, Tanzania and Bangladesh. Co-occurrence network visualization explains the network or relationship from one term to another in research in the field of earnings management for the 2017-2023 period. While the visual overlay represents keywords indicating the year of publication, the density visualization indicates research on a topic that is still very broad to study. These findings also indicate that it is important to recognize the approaches and theories behind the development of Economic Performance to determine the gradual nature of the aspects involved in it. Keywords: Bibliometrics; Profit management; Digital Library; Scopu
PERAN GANDA ISTRI PETANI (Studi Kasus di Desa Perangian Kecamatan Baraka Kabupaten Enrekang)
Full text linkMULTIPLE ROLES FARMER’S WIFE
(Case Study in Perangian village of Baraka subdistrict in
enrekang district)
ABSTRAK
Perempuan di desa perangian bekerja sebagai tenaga kerja domestik tidak mendatangkan hasil secara langsung seperti menjaga anak, Dipihak lain sesuai dengan perkembangan masyarakat khususnya pada bidang ekonomi, Nampak dengan nyata peran Perempuan sebagai tenaga dibidang pencari nafkah yang mendatangkan hasil secara langsung. Hasil penelitian menunjukkan bahwa penyebab perempuan buruh tani melakukan peran ganda adalah faktor intern yaitu pendapatan suami tidak mencukupi kebutuhan hidup sehari hari, ditambah dengan pengeluaran dan jumlah tanggungan dalam keluarga, faktor ekstern yaitu lingkungan sekitar yang berupa lahan pertanian yang banyak membutuhkan tenaga buruh tani, pendidikan yang rendah tidak memiliki keterampilan yang memadai sehingga tidak ada peluang untuk kerja lainya. Bentuk peran ganda yaitu sebagai Ibu, merawat anak dan suami, sebagai istri, mendidik anak dan ekonomi. Dampak peran ganda bagi keluarga yaitu kesulitan dalam menjalankan tugas domestiknya, kurang optimalnya waktu yang dimiliki untuk membagi peran yang dijalankan, Kelelahan beraktivitas dalam pekerjaannya secara profesional, dan terjadi pengeluhan dirasakan oleh istri terhadap suami ketika mereka sudah lelah dalam bekerja.
Kata Kunci: Istri petani, peran ganda.
ˡ Mahasiswa Program Pasca Serjana Pendidikan Sosiologi Universitas Negeri Makassar Angkatan 2014.
MULTIPLE ROLES FARMER’S WIFE
(Case Study in Perangian village of Baraka subdistrict in
enrekang district)
Suparman
ABSTRACT
The type of this research is a study case with qualitative desrictive aproach. the informant is chosen by purposive sampling technique, who as mother and farm worker. The data is obtained by employing Observation, Interview, and Documentation. The datais analysed by using descriptive qualitative analysis technigue. The results of the research reveal that factors causingthe farmer’s wife to do multiple roles arethe internal and external factors. The internal factors are the husband’s income connot fulfill the daily needs, not to mention the number of famillymembers. The external factors are the invorenment conditions of farming fields which need lots of workers, low education and lack of adequate skills causing no chance for others jobs. The forms of multiple roles as a mother are nurturing the children and husband, and as a wife educating the children and helping family’s economic matter. The impacts of multiple roles are difficulty in conducting her domestic jobs, less time to distribute equal time with multiple roles carried out, tiridness to conduct the job professionally, and complains to husband when she is tired due to multiple roles.
Keyword : farmer’s wife, multiple role
تأثير تطبيق نموذج على نتائج تعلّم اللغة العربية لتلاميذ الفصل الثامن في المدرسة الثانوية بونتوتئني (Teams Games Tournament)
Full text linkنتائج تعلم اللغة العربية للتلاميذ الفصل الثامن في المدرسة الثانوية بونتوتئني قبل تطبيق نموذج Teams games Tournament يمكن أن يكون متوسط القيمة قبل تطبيق هذا النموذج هو 56.92 مع انحراف معياري 10.17. نتائج تعلم اللغة العربية للتلاميذ الفصل الثامن في المدرسة الثانوية بونتوتئني بعد تطبيق نموذج Teams games Tournament يمكن أن يكون متوسط القيمة بعد تطبيق هذا النموذج هو 78.46 مع انحراف معياري قدره 8.61. هناك تأثير في نتائج تعلّم اللغة العربية لتلاميذ الفصل الثامن في المدرسة الثانوية بونتوتئنى بعد تطبيق نموذج Teams games Tournament
INDUSTRI KREATIF SENI GRAFIS SABLON CETAK SARING UPAYA PEMBERDAYAAN MASYARAKAT DESA KREMBUNG KECAMATAN KREMBUNG KABUPATEN SIDOARJO
Full text linkTujuan program KKN-PPM ini adalah untuk mengatasi masalah yang dijumpai di desa Krembung yaitu rendahnya pendapatan warga, rendahnya pengetahuan dan pemahaman tentang pembuatan seni grafis sablon cetak saring terutaman pemanfaatan waktu senggang menunggu hasil panen untuk dimanfaatkan dalam pembuatan seni grafis sablon cetak saring. Mengingat sebagian besar warga desa krembung bercocok tanam. sehingga belum maksimalnya waktu senggang sembari menunggu hasil panen musiman. Solusi untuk menyelesaikan permasalahan tersebut adalah memberdayakan masayarakat desa melalui program ekonomi kreatif seni grafis sablon cetak saring serta memberikan keterampilan teknologi pembuatan sablon cetak saring. Dilakukan pelatihan dan pendampingan pembuatan sablon cetak saring guna peningkatan ekonomi warga. Diharapkan melalui program ini tercipta kemandirian ekonomi dan terjadi peningkatan pendapatan keluarga.
Kata kunci : Industri kreatif, Seni grafis, Waktu senggang
 
Membangun Kerja Sama Pemimpin di Sekolah Kristen: Perspektif Teologis atas Hambatan dan Solusinya
Full text linkCollaboration among leaders is a foundational aspect of leadership in Christian schools, rooted in the unity of the body of Christ. However, such collaboration does not occur automatically and is often hindered by personality differences, unstable faith, and divergent goals or personal interests. This article aims to analyze the obstacles to cooperation among leaders in Christian school settings by examining biblical narratives and proposing solutions from a theological perspective. Using a reflective-theological approach and current literature, this article highlights that Christian collaboration is not merely an administrative strategy, but an expression of koinonia—a fellowship that mirrors the loving relationship within the Triune God. Proposed solutions include spiritual and character formation, spiritual mentoring, restorative conflict resolution, and reaffirming a shared vision. These insights are intended to foster a more authentic and transformative model of Christian leadership within educational communities.Kerja sama antar pemimpin merupakan fondasi penting dalam kepemimpinan sekolah Kristen yang berlandaskan pada kesatuan tubuh Kristus. Namun dalam praktiknya, kerja sama tidak terjadi secara otomatis, bahkan sering mengalami hambatan yang bersumber dari perbedaan kepribadian, ketidakseimbangan iman, serta perbedaan orientasi dan kepentingan. Artikel ini bertujuan untuk menganalisis hambatan-hambatan kerja sama antar pemimpin dalam konteks sekolah Kristen melalui kajian naratif tokoh-tokoh Alkitab dan mengusulkan solusi berdasarkan perspektif teologis. Dengan pendekatan reflektif-teologis dan literatur terkini, artikel ini menyoroti bahwa kerja sama Kristen bukan sekadar strategi administratif, melainkan perwujudan koinonia yang mencerminkan relasi kasih Allah Tritunggal. Solusi yang ditawarkan meliputi formasi karakter rohani, mentoring spiritual, pendekatan restoratif dalam konflik, dan peneguhan visi bersama. Diharapkan, pemahaman dan praktik ini mendorong terbangunnya kepemimpinan Kristen yang transformatif dan otentik dalam komunitas pendidikan
- …
