66,368 research outputs found
Liphistius liz Lin & Li 2023, sp. nov.
<p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329
Gastrodia elata Bl. f. cyaneum L. B. Lin: A new form of Gastrodia (Orchidaceae) in Yunnan
[Objective] Gastrodia elata Bl. f. cyaneum L. B. Lin represents a newly identified form of
Gastrodia originated from Xiaocaoba Town of Zhaotong in Yunnan, providing comprehensive documentation
of morphological characteristics with color photographs. [Methods] The aim was to identify G. elata
f. cyaneum as a novel form by meticulous dissection, morphological examination, and comparative analysis
with established specimens and literatures. [Results] Distinguished features that set G. elata f. cyaneum
apart include an inverted egg-shaped tuber, the protruding, long, gray-green terminal bud, and the
clear blue color of the floral axis, flowers, and capsules. [Conclusion] This research identify G. elata f.
cyaneum as a novel form, which not only enriches the diversity of orchids, but also presents valuable resources
for the breeding of G. elata
Lysmata bahia Rhyne & Lin 2006
<i>Lysmata bahia</i> Rhyne & Lin, 2006 <p> <i>Lysmata bahia</i> Rhyne & Lin, 2006: 191, figs. 16–18, pl. 1F.</p> <p> <b>Material examined.</b> None.</p> <p> <b>Distribution.</b> Western Atlantic—Panama and Brazil (Ceará, Sergipe, Bahia, Rio de Janeiro, São Paulo) (Rhyne & Lin 2006; Baeza 2008; Barros-Alves <i>et al</i>. 2015; Pachelle <i>et al</i>. 2016).</p> <p> <b>Previous records.</b> Santos Harbor (paratypes collected in 1950 and deposited at USNM) (Rhyne & Lin 2006).</p>Published as part of <i>Terossi, Mariana, Almeida, Alexandre O., Buranelli, Raquel C., Castilho, Antonio L., Costa, Rogério C., Zara, Fernando J. & Mantelatto, Fernando L., 2018, Checklist of decapods (Crustacea) from the coast of the São Paulo state (Brazil) supported by integrative molecular and morphological data: I. Infraorder Caridea: families Hippolytidae, Lysmatidae, Ogyrididae, Processidae and Thoridae in Zootaxa 4370 (1)</i>, DOI: 10.11646/zootaxa.4370.1.6, <a href="http://zenodo.org/record/1138546">http://zenodo.org/record/1138546</a>
Appropriate Similarity Measures for Author Cocitation Analysis
We provide a number of new insights into the methodological discussion about author cocitation analysis. We first argue that the use of the Pearson correlation for measuring the similarity between authors’ cocitation profiles is not very satisfactory. We then discuss what kind of similarity measures may be used as an alternative to the Pearson correlation. We consider three similarity measures in particular. One is the well-known cosine. The other two similarity measures have not been used before in the bibliometric literature. Finally, we show by means of an example that our findings have a high practical relevance.information science;Pearson correlation;cosine;similarity measure;author cocitation analysis
Synthesis and Properties of Shape Memory Poly(gamma-Benzyl-L-Glutamate)-b-Poly(Propylene Glycol)-b-Poly(gamma-Benzyl-L-Glutamate)
Shape memory polymers (SMPs) have attracted much attention as an important class of stimuli-responsive materials for biomedical applications. For SMP-based biomaterials, in addition to suitable shape recovery performances, their mechanical properties, biodegradability, biocompatibility, and sterilizability needs to be considered. Polypeptides can satisfy the requirements outlined above. However, there are few reports on shape memory polypeptides. In this paper, shape memory poly(gamma-benzyl-L-glutamate) (PBLG-PPG-PBLG) was synthesized by ring-opening polymerization of gamma-benzyl-L-glutamate-N-carboxyanhydrides (BLG-NCA) with poly(propylene glycol) bis(2-aminopropyl ether) as the macroinitiator. H-1 Nuclear Magnetic Resonance (NMR) and Fourier-Transform Infrared Spectroscopy (FTIR) were used to characterize the structure of the obtained PBLG-PPG-PBLG. The FTIR analysis showed that PBLG-PPG-PBLG has alpha-helical and beta-sheet structures. PBLG-PPG-PBLG has good shape memory properties, its shape recovery time is less than 120 s, and its shape recovery rate is 100%. In this study, we reported a simple synthetic method to obtain intelligent polypeptide materials, which will be used in many biomedical applications
SPATIAL CHOW-LIN METHODS: BAYESIAN AND ML FORECAST COMPARISONS
Completing data that are collected in disaggregated and heterogeneous spatial units is a quite frequent problem in spatial analyses of regional data. Chow and Lin (1971) (CL) were the rst to develop a uni ed framework for the three problems (interpolation, extrapolation and distribution) of predicting disaggregated times series by so-called indicator series. This paper develops a spatial CL procedure for disaggregating cross-sectional spatial data and compares the Maximum Likelihood and Bayesian spatial CL forecasts with the naive pro rata error distribution. We outline the error covariance structure in a spatial context, derive the BLUE for the ML estimator and the Bayesian estimation procedure by MCMC. Finally we
apply the procedure to European regional GDP data and discuss the disaggregation assumptions. For the evaluation of the spatial Chow-Lin procedure we assume that only NUTS 1 GDP is known and predict it at NUTS 2 by using employment and spatial information available at NUTS 2. The spatial neighborhood is de ned by the inverse travel time by car in minutes. Finally, we present the forecast accuracy criteria comparing the predicted values with the actual observations.
Ganoderma tsugae supplementation alleviates bronchoalveolar inflammation in an airway sensitization and challenge mouse model.
Branching fraction and CP asymmetry of the decays B+→K0Sπ+ and B+→K0SK+
An analysis of B+ → K0
Sπ+ and B+ → K0
S K+ decays is performed with the LHCb experiment. The pp
collision data used correspond to integrated luminosities of 1 fb−1 and 2 fb−1 collected at centre-ofmass
energies of
√
s = 7 TeV and
√
s = 8 TeV, respectively. The ratio of branching fractions and the
direct CP asymmetries are measured to be B(B+ → K0
S K+
)/B(B+ → K0
Sπ+
) = 0.064 ± 0.009 (stat.) ±
0.004 (syst.), ACP(B+ → K0
Sπ+
) = −0.022 ± 0.025 (stat.) ± 0.010 (syst.) and ACP(B+ → K0
S K+
) =
−0.21 ± 0.14 (stat.) ± 0.01 (syst.). The data sample taken at
√
s = 7 TeV is used to search for
B+
c
→ K0
S K+ decays and results in the upper limit ( fc · B(B+
c
→ K0
S K+
))/( fu · B(B+ → K0
Sπ+
)) <
5.8 × 10−2 at 90% confidence level, where fc and fu denote the hadronisation fractions of a ¯b
quark
into a B+
c or a B+ meson, respectively
Glenea changchini Lin & Lin, 2011, sp. nov.
Glenea changchini sp. nov. (Figs 1–8) Description (based on three males): Male: length: 21.8 –24.0 mm, humeral width: 6.2–6.7 mm. Body dark violet. Head violet-black, with two light blue pubescent stripes on occiput, which extend around superior eye lobes and antennal tubercles. Frons with inferior eye lobes surrounded with light blue pubescent stripes which cross genae and reaching clypeus; tempora covered with light blue pubescence. Antenna red brown, basal three antennomeres darker and with light blue pubescence on ventral and inner sides, others with a faint grayish pubescence. Prothorax dark violet, pronotum with three light blue pubescent stripes (one median and one on each lateral margin) and each side with a large white patch around coxa (propleura pubescent). Scutellum with white or light blue pubescence. Elytron dark violet, with 9–11 snow-white or light blue markings (named in Fig. 3); A, B at basal fourth and C at apical fourth are more stable than others in both position and shape; D and d are smaller and sometimes absent; E-e, F-f and G-g forming oblique lines and sometimes confluent; e, f and g are quite variable in shape. Ventral surface reddishviolet; with several whitish maculae: mesepisternum, mesepimeron and most of metepisternum whitish pubescent; two patches on each side of apical abdominal segments 1–4; other parts with fulvous brown pubescence. Femora reddish-brown and glossy; tibiae and tarsi reddish-brown and with hair and pubescence, especially apical part of hind tibiae and tarsi densely covered with fulvousbrown hair and pubescence. Head slightly narrower than prothorax. Eyes medially emarginate, inferior eyelobes two times as high as genae below. Antennae relative slender, longer than body (9 th antennomere reaching elytral apex); antennomere ratio: male: 25: 5: 40: 30: 30: 27: 27: 23: 23: 22: 30. Last antennomere (Fig. 4) subdivided at apical third. Prothorax densely punctured, slightly narrower from base to apex. Elytron densely and coarsely punctured, gradually narrower apically, with 2 lateral carinae, neither from base nor reaching apex; apex transversely truncated, rounded at inner angle and with a very minute and scarcely perceptible tooth at outer angle. Legs slender, middle tibiae hardly grooved, hind femur reaching fourth abdominal segment, first hind tarsal segment subequal to following two segments combined. Tarsal claws simple. Male genitalia (Figs 5–7): Tegmen length about 3.4 mm; lateral lobes stout, each about 0.7 mm long and 0.3 mm wide, with a curved ridge at base; apex with fine setae shorter than half of lateral lobes; basal piece well-developed and not bifurcated; median lobe plus median struts slightly curved (Fig. 5 b), obviously longer than tegmen (22: 17); median struts more than half of whole median lobe in length; dorsal plate shorter than ventral plate; apex of ventral plate (Fig. 6) rounded; median foramen elongated, pointed at apex (angle about 30 degree); internal sac more than twice as long as median lobe plus median struts, with four pieces of basal armature (located at middle of median struts), two bands of supporting armature (very weak), and three rods of endophallus, rods subequal, each about 3.8 mm, longer than tegmen. Tergite VIII (Figs 8 a, 8 c) much broader than long, apex truncated to slightly emarginated, with moderate long setae at sides, setae in the middle shorter and sparser. Sternite IX subequal to ringed part of tegmen in length. Female unknown. Diagnosis. Though the external appearance is similar to G. diana, G. paradiana and G. subsimilis, this species differs not only by the pubescent markings, but also in the following characters: elytral apex rounded at the inner angle (usually bidentate in Glenea), claws simeple, and basal armature located at middle of median struts (usually located out of median lobe in other Glenea spp.). Etymology. The species is named after Mr. Changchin Chen (Tianjin, China), who offered the authors lots of material, support and kind help in various ways. Remarks. The species is similar to subgenera Rubroglenea (pronotal puncturation and elytral apex different) and Macroglenea (male claw, genitalia and elytral apex different). The genus Glenea, as considered here, includes a diverse, and probably multi-generic assemblage of species. For example, some Heteroglenea species were previously placed in Glenea (Lin et. al, 2009). To clarify the subgeneric and generic relationships, a world-wide study of Glenea is required. Distribution. China: Yunnan. Material examined. Holotype (23.0 mm long), male, China, Yunnan prov., Jinping county, Ma’andi, Biaoshuiyan (22 ° 44 'N 103 ° 29 'E), alt. 1350 m, 2010. V. 13, leg. Xiaodong Yang (IZAS, IOZ (E) 1859451). Paratypes: 1 male, Yunnan prov., Jinping county, Ma’andi, Biaoshuiyan (22 ° 44 'N 103 ° 29 'E), alt. 1350 m, 2010. V. 15, leg. Wenhsin Lin (CCCC); 1 male (21.8 mm long), same data (IZAS, IOZ (E) 1859452). Correction. In the paper “Eight species of the genus Glenea Newman, 1842 from the Oriental Region, with description of three new species (Coleoptera: Cerambycidae: Lamiinae: Saperdini). Zootaxa, 2155: 1–22 ”, there is an error which needs correction. In Figures 25–26 on page 12, ‘ subrubricollis ’ in 25 L and 26 L should read ‘ nigrorubricollis ’. We thank Dr. Carolus Holzschuh (Villach, Austria) for bringing this to our attention.Published as part of Lin, Meiying & Lin, Wenhsin, 2011, Glenea changchini sp. nov. from Yunnan of China (Coleoptera: Cerambycidae: Lamiinae: Saperdini), pp. 13-17 in Zootaxa 2987 on pages 13-14, DOI: 10.5281/zenodo.20811
- …
