58 research outputs found

    ASİYA CEBBAR’IN BABA EVİNDE BANA YER YOK ADLI ESERİNDE SÖMÜRGE KÜLTÜRÜ VE MÜSLÜMAN KADININ YAŞADIĞI ZORLUKLAR

    No full text
    Asiya Cebbar’ın Baba Evinde Bana Yer Yok adlı eserinde, yazar/anlatıcı, hafızasına yeniden dönerek çocukluk, ergenlik ve yetişkinlik anılarını zihninde canlandırır. Bu anlatı sırasında babası özellikle onun çocuk bilincinde ve daha sonraki yaşantısında önemli bir rol oynar. Bazen taş yürekli bir sansürcü olur, bazen de özgürlükçü olur. Ama yine de Asiya ona gizliden gizliye bir hayranlık duyar. Babasının bu belirsiz tavırları içinde kendini şekillendirmeye çalışır. Aslında Asiya Cebbar, kendi anıları arasında Fransız sömürgesi altında kalmış ülkesinin en önemli iki sorununa değinmeye çalışmaktadır. Birisi dayatılan sömürge kültürünün sonucu olarak ortaya çıkan kimlik sorunu, diğeri de Cezayir kadınının özgürlük mücadelesidir. Sömürge altında olsun veya sömürgeci ülke içinde olsun, insanlar, iki dil ve iki kültür arasında ne yapacaklarını, nasıl davranacaklarını bilememekte, doğal olarak kimlik bunalımı içinde boğulmaktadırlar. Asiya, yaşadığı toplumda kadının maruz kaldığı sıkıntıları kendi penceresinden gözler önüne sermeye çalışır. Hakim kültürün giyim tarzı, alışkanlıkları, dinî inanış ve değer yargılarıyla beslenirken, yatılı okulda okuduğu kitapların tesiri ve yurttaki Avrupalı kız arkadaşlarının yaşam anlayışlarıyla bambaşka bir dünyanın varlığını keşfeder, özgürlüğü tadar. Yazar, sömürgecilerin baskısıyla çok büyük değişimlere zorlanan Cezayir toplumunda, kendi hayatını resmederek kadının özgürleşmesinde öncü rolü üstlenmiştir.The author/narrator animates the memories of childhood, puberty and adulthood returning again to the memory in the novel named Baba Evinde Bana Yer Yok of Asiya Cebbar. During this narration, her father plays an important role especially in her conscious and in her future life. He sometimes becomes a hard-hearted censor and sometimes libartarian. But Asiya still admires him secretly. She tries to shape herself in this uncertain attitude of his father. In fact, Asiya Cebbar tries to mention two major problems among her memories of her country trapped under the French colony. One of them is the problem of identity revealed as the result of the colonial culture imposed, and the other one is the fight for freedom of Algerian woman. Whether being colonized or being in the colonizing countries, people might not know what to do and how to act, and they naturally are drowned in a crisis of identity. Asiya tries to display the problems that the women face in the society she lives in from her point of view. While she is exposed to the clothing style, habits, religion and values of dominant culture, she discovers the presence of a completely different another world with the influence of books she read at school and with the life styles of her friends in the dorm which she tastes freedom. The author, portraying her own life, plays a leading role on the freedom of woman in the Algerian society which has been forced to make important changes under the pressure of colonizing countries

    Poligami dalam Perspektif Teori Batas (Studi Pemikiran Muhammad Shahrur)

    No full text
    This article describes polygany in the perspective of Limit Theory of Muhammad Shahrur. Polygamy is an issue of islamic law which create controversy among Muslim community. In al-Qur’an, the only verse dealing with polygamy is al-Nisa: 3. Using the limit theory (nazariyyah al-hudud) of Muhaamad Shahrur the verse produces two kinds of limit; the limit of quantity (hadd fi al-kamm) and the limit of quality(hadd fi al-kaif). From the analysis on the foundation of Shahrur’s thought on polygamy, it is apparent that he emphasizes on the protection of orphans because they must be protected and fed. This condition, according to Shahrur, indicates validity of polygamy on the importance of taking cares of orphans towards those who no longer have fathers

    Using Graphical organizers in the teaching process of ICT

    No full text
    To date, hundreds of advanced teaching methods have been developed, such as game methods, problem-based learning methods, and information and communication technologies are widely used in education. Most of these technologies are based on the principles of student-centred and participatory learning. These interactive methods allow the learner to master the necessary professional knowledge, skills and competencies under the managerial guidance of a teacher. In this article, the author would like to share her experience of using one of such techniques - graphic organizers - in teaching the subject of computer science and information technologies. The graphic organizers as supportive tools for teaching and learning, their use and types are described. Examples of graphic organizers for learning IT and Information security, drawn using IT, are given

    The Reality of Violence Against Wives: Dynamics of Social Settlement and Support in Lamongan, East Java

    No full text
    As a hidden crime, violence against wives is considered a disgrace to be discussed in public, especially reported to state and non-state actors. At first, victims feel able to resolve violence without outside intervention from outside their household, but repetition after repetition of violence requires them to choose what kind of resolution is right for them. This choice should be made after they have the support of individuals in their social environment. This study aims to explore the knowledge and experience of victims of violence against wives in choosing one among legal norms favorable to them. This study uses a critical realist approach by collecting qualitative data with dialogue techniques and observations of three women who were victims and six people who provided support to victims. We conclude that victims experience a dynamic psychological state, where initially, they always try to maintain the integrity of their household. The dominance of men and the subordination of women as a reality of cultural norms are essential factors in choosing ways of resolving conflicts at the community level, and we consider that the community has succeeded in providing social support to victims so that victims feel they get help and defense. However, we hope that this social support can be carried out through structured, systematic, and massive protection of victims of violence from State and non-state actors while considering the cultural norms of the community and supporting the identification of violence

    Taxonomy based Data Marts

    No full text

    Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

    No full text
    Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5’AACAGACGGGTAGTCATGATTGAG3’ R5’GTATCTGATCGTCTTCACTCCC3’. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy

    The Battle of the Trench: Defensive Strategy and Allied Organization: غزوہ خندق: دفاعی حکمت عملی اور اتحادی نظم

    No full text
    The Battle of the Trench (Ghazwa-e-Khandaq) marks a pivotal moment in Islamic military history where the Prophet Muhammad ﷺ introduced an unprecedented defensive tactic—digging a trench around Madinah. This battle exemplified both military ingenuity and a remarkable display of allied unity under pressure. In today's world, where warfare has shifted from brute force to strategic diplomacy and collective defense, the lessons of the Battle of the Trench remain timeless. It teaches the importance of consultation, strategic foresight, and building alliances for common defense. This battle serves as a model for modern Muslim societies facing external and internal challenges. Despite limited resources, the Muslims of Madinah effectively repelled a powerful coalition through strategic defense and communal solidarity—principles still essential in modern geopolitics. The key research questions include: What were the core defensive strategies employed during the Battle of the Trench? How was the alliance of various tribes and groups successfully managed? What can contemporary Muslim leadership learn from this event? This paper follows a historical-analytical approach. It draws upon primary sources, supplemented by modern interpretations from military historians and political analysts. The primary research questions guiding this inquiry are: What are the core principles and components of an education system derived from the Prophetic tradition? How can these timeless principles be operationalized within the administrative and curricular structures of a modern state? What societal benefits—such as enhanced social cohesion, ethical governance, and sustainable development—could arise from implementing such a model? The methodology involves a qualitative analysis of primary Islamic sources (the Quran and Sunnah) alongside a review of historical Islamic educational institutions and contemporary scholarship on education philosophy. The study concludes that the Prophetic model provides a robust, values-based architecture for education that addresses the limitations of purely materialistic systems. It offers the potential to foster a society grounded in knowledge ('ilm), ethical consciousness (taqwa), and public welfare (maslaha). The findings are significant for policymakers and educators seeking to develop education systems that harmonize material progress with spiritual and moral integrity
    corecore