943 research outputs found
HIGH RESOLUTION INFRARED SPECTRA OF THE ) OZONE MOLECULE (1200 TO . LINE POSITIONS
No full textAuthor Institution: Groupe de Spectrom\'etrie Mol\'eculaire et Atmosph\'erique, UMR CNRS 6089 Universit\'e de Reims - Moulin de la Housse - BP 1039After the previous systematic analysis of in medium infrared, we present here the results of the analysis of new observed bands. The spectra have been recorded with the FTS of , with a resolution of , and products pathlength pressure up to Torr. The data reduction to derive line positions uses a new multifit . The analysis of spectra is performed using the same formalism as in references [1-4], using standard Watson's Hamiltonian for diagonal blocks and Coriolis and Fermi resonances for off diagonal blocks. 8 polyads have been analysed, among them 7 being analysed for the first time. They correspond to 10 observed bands (underlined) in interaction with ``dark'' bands. We give here the range of J and for observed transitions, statistics for energy levels, spectroscopic parameters and resonance coupling parameters. Acknowledgments: Authors thank S.A Tashkun for use of GIP programs, X. Thomas and P. Von der Heyden for recording spectra, L. R\'{e}galia and J. J. Plateaux for the use of multifit program. 1. S. M. Mikhailenko, A. Barbe, VI. G. Tyuterev and A. Chichery, Atmos. Oceanic Opt., 12, 9 (1999) 2. A. Chichery, A. Barbe, VI. G. Tyuterev, J. Molecular Spectrosc., 206, 1 - 26 (2001) 3. A. Chichery, A. Brabe, VI. G. Tyuterev, S.A. Tashkun, J. Molecular Spectrosc., 205, 347-349 (2001) 4. M. R. De Backer Barilly, A. Barbe, VI. G. Tyuterev, A. Chichery, Mol. Phys., accepted (2002). 5. J.J. Plateaux, A. Barbe, and A. Delahaigue, Spectrochim. Acta, A 51, 1153-1196 (1995). 6. L. R\'{e}galia, Thesis Universit\'{e} de Reims, (France) (1996). 7. J.J. Plateaux, L. R\'{e}galia, C. Boussin and A. Barbe, J.Q.S.R.T., 68, 507-520 (2001)
NEW DATA ON OZONE IN THE 5 RANGE: LINE STRENGTHS AND AIR BROADNING COEFFICIENTS
No full text C. SECROUN, A. BARBE, P. JOUVE, PH ARCAS, E. ARIE, J. Mol. Spectry., 84, 8-15 (1981)Author Institution:By using the ozone generation and pressure measurement as described in reference 1, we have recorded with a SISAM spectrometer ( resolution), a large number of spectra between 2084 and , with different pressures (from 0.05 to 10 torrs) and different path lengths. The line strengths have been derived by the equivalent width method. The nitrogen and oxygen broadnings have been obtained by filling the cells at different pressures (from 40 to 760 torrs) and using the direct method. All these results have been confirmed by least squares applied to synthetic spectra
PRESSURE BROADENING OF LINES IN THE REGION
No full text M. A. H. Smith, C. P. Rinsland, V. Malathy Devi, J.-M. Flaud, C. Camy-Peyret, and A. Barbe, J. Mol. Spectrosc., 139, 171-181 (1990). C. Camy-Peyret, J.-M. Flaud, M. A. H. Smith, C. P. Rinsland, V. Malathy Devi, J. J. Plateaux, and A. Barbe, J. Mol. Spectrosc., in press (1990).Author Institution: Atmospheric Sciences Division, Mall stop 401A, NASA Langley Research Center; Physics Department, College of William and Mary; Atmospheric Sciences Division, Mail stop 401A, NASA Langley Research CenterWe have recorded a series of high-resolution absorption spectra of ozone broadened by dry air, by , and by at room temperature using the McMath Fourier transform spectrometer at the National Solar Observatory on Kitt Peak. The spectra cover a wavenumber range from approximately to at a resolution of . Using recently-determined line positions, assignments, and , we have analyzed these spectra to determine pressure broadening and line shift coefficients for a number of lines in the and , band systems
Barbe (Birth, 1885-03-20)
No full textAddress: 12 Watson Ave.1589/Pg.160/1885/M W/Twin/Ohio/Ohio/S. V. Wiseman, M. D.Original record filed in drawer labeled 'BALL-BARD'
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
No full textLittle is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Peer reviewe
H. R. INFRARED SPECTRUM OF : AANALYSIS OF THE TRIAD , and
No full text[1] J. J. PLATEAUX, D. COURTOIS, A. DELAHAIGUE, A. BARBE and P. JOUVE Rev. Phys. Appliquee 21, 239-244 (1986) [2] C. CAMY-PEYRET, J.M. FLAUD, M.A. SMITH, C. P. RINSLAND, V.M. DEVI, J. J. PLATEAUX and A. BARBE, J. Mol. Spectry 141, 134-144 (1990)""Author Institution: Universit{\'e} de Reims, URA 1434, UFR Sciences; Laboratoire de Physique Mol{\'e}culaire et Atmosph{\'e}rique, Universite P.M. Curie et CNRS Tour 13High resolution spectra of in the 5 have never been recorded up to now. To derive intensities and positions of the lines of isotopic ozone a set of sepctra have been obtained with the new F. T. S. built in Reims [1]. The spectra of 98\% introduced in the absorption cell of 31.2 cm long, at different pressures (9.4 Torrs, 6 Torrs, 4 Torrs) have been performed in one hour, with a signal to noise ratio of 800, at resolution of corresponding to a 3 m path difference, using stepping mode. The observed experimental results are derived from least squares fits on line shape. The accuracy is 7 for wavenumbers and 4\% for absolute intensities. For the analysis we used Watson’s type hamiltonian [2] with 22 constants for each vibrational state (200, 101 and 002) and 9 coupling constants for Coriolis and Darling-Dennisson resonances betwen these states. Finally, we give all the set parameters, a portion of listing with assignments observed and calculated wavenumbers and intensities, as well as standard deviation for and S
Investigation and management of residual sleepiness in CPAP-treated patients with obstructive sleep apnoea: the European view
No full textExcessive daytime sleepiness (EDS) is a major symptom of obstructive sleep apnoea (OSA), defined as the
inability to stay awake during the day. Its clinical descriptors remain elusive, and the pathogenesis is
complex, with disorders such as insufficient sleep and depression commonly associated. Subjective EDS
can be evaluated using the Epworth Sleepiness Scale, in which the patient reports the probability of dozing
in certain situations; however, its reliability has been challenged. Objective tests such as the multiple sleep
latency test or the maintenance of wakefulness test are not commonly used in patients with OSA, since
they require nocturnal polysomnography, daytime testing and are expensive. Drugs for EDS are available
in the United States but were discontinued in Europe some time ago. For European respiratory physicians,
treatment of EDS with medication is new and they may lack experience in pharmacological treatment of
EDS, while novel wake-promoting drugs have been recently developed and approved for clinical use in
OSA patients in the USA and Europe. This review will discuss 1) the potential prognostic significance of
EDS in OSA patients at diagnosis, 2) the prevalence and predictors of residual EDS in treated OSA
patients, and 3) the evolution of therapy for EDS specifically for Europe
Modernist Irony and a New Type of Biography: Eminent Victorians by Lytton Strachey
No full textThe article argues that Lytton Strachey’s Eminent Victorians (1918) exemplifies the use of modernist irony, as defined by AlanWilde in Horizons of Assent: Modernism, Postmodernism, and the Ironic Imagination (1981). The Polish translation of Strachey’s book, which includes only two of the four original essays, while losing the ironic undertones of the title in Ludzie epoki Wiktorii, keeps some significant characteristics discussed by Wilde, such as disjunction, paradox and parataxis. Strachey’s disjunctive irony, his awareness of life’s incongruities and disparities, his perspective of distance and detachment, as well as his employment of narrative techniques suggesting discontinuity, fleeting impression and subjectivity – all lie at the root of the new form of biography as a [email protected] Maria Tomczak, dr hab., adiunkt w Instytucie Neofilologii Uniwersytetu w Białymstoku, jest autorką książek Reading Class: Nonverbal Communication as a Reflection of Middle Class Attitudes and Behaviours in Selected Novels of Iris Murdoch (2009) oraz Cultural Memory and Food: South Asian Diasporic Fiction (2012).Wydział Filologiczny, Uniwersytet w BiałymstokuAllemann Beda, O ironii jako o kategorii literackiej, przeł. M. Dramińska-Joczowa, w: Ironia, red. M. Głowiński, Gdańsk: Słowo/obraz terytoria, 2002, s. 17–41.Adamczyk-Garbowska Monika, Polskie tłumaczenia angielskiej literatury dziecięcej. Problemy krytyki przekładu, Wrocław: Zakład Narodowy im. Ossolińskich, Wydawnictwo PAN, 1988.Altick Richard D., Eminent Victorianism. What Lytton Strachey Hath Wrought, „The American Scholar” 1995, vol. 64, no 1 (Winter), s. 81–89.Barbe Katherina, Irony in Context, Amsterdam/Philadelphia: John Benjamins, 1995.Bov´e Paul A., Modern Irony and the Ironic Imagination, „Contemporary Literature” 1982, vol. 23, issue 2 (Spring), s. 244–254.Dane Joseph A., The Critical Mythology of Irony, Athens and London: U. of Georgia Press, 2011.Głowiński Michał, Ironia jako akt komunikacyjny, w: Ironia, red. M. Głowiński, Gdańsk: Słowo/obraz terytoria, 2002, s. 5–16.Hamilton Nigel, Biography. A Brief History. Cambridge, Ma. and London: Harvard UP, 2007.Haan de Binne, Renders Hans, Towards Traditions and Nations, w: Theoretical Discussions of Biography: Approaches from History, Microhistory and Life Writing, eds. B. de Haan, Binnee, H. Renders, Leiden: Brill, 2014, s. 11–23.Hooper Brad, Another Look At: Lytton Strachey’s „Eminent Victorians”, „Booklist” 2011, vol. 107, issue 19/20, s. 28.Houghton Walter, The Victorian Frame of Mind, 1830–1870, New Haven and London: Yale University Press, 1985.Hutcheon Linda, Irony’s Edge: The Theory and Politics of Irony, London and New York: Routledge, 1995.Hutcheon Linda, „Ironia, satyra, parodia – o ironii w ujęciu pragmatycznym”, przeł. K. Górska, w: Ironia, red. M. Głowiński, Gdańsk: Słowo/obraz terytoria, 2002, s. 165–190.Kerbrat-Orecchiani Catherine, Ironia jako trop, przeł. M. Dramińska-Joczowa, w: Ironia, red. M. Głowiński, Gdańsk: Słowo/obraz terytoria, 2002, s. 109–143.Korwin-Piotrowska Dorota, Poetyka: przewodnik po świecie tekstów, Kraków: Wydawnictwo Uniwersytetu Jagiellońskiego, 2011.Łaguna Piotr, Ironia jako postawa i jako wyraz, Kraków–Wrocław: Wydawnictwo Literackie, 1984.May Brian, TheModernist as Pragmatist: E.M. Forster and the Fate of Liberalism, Columbia and London: Univ. of Missouri Press, 1997.McCrum Robert, „Eminent Victorians”, „Guardian”, 16 stycznia 2017.Melbye David, Irony in the Twilight Zone: How the Series Critiqued Postwar American Culture, Lanham: Rowman and Littlefield, 2016.Miller Tyrus, Late Modernism: Politics, Fiction, and the Arts between the World Wars, Berkeley–Los Angeles–London: U. of California Press, 1999.Mitosek Zofia, Co z tą ironią?, Gdańsk: Słowo/obraz terytoria, 2013.Muecke D. S., Ironia: podstawowe klasyfikacje, przeł. G. Cendrowska, w: Ironia, red. M. Głowiński, Gdańsk: Słowo/obraz terytoria, 2002, s. 43–74.Paxman Jeremy, Empire, London: Penguin Books, 2011.Reviron-Pi´egay Floriane, The Age of Outrage: Eminent Victorians: Outrageous Strachey? The Indecent Exposure of Victorian Characters and Mores, „´Etudes britanniques contemporaines” 2013, nr 45, https://ebc.revues.org/638, DOI: 10.4000/ebc.638.Rodriguez Rosique Susana, The power of inversion. Irony, from utterance to discourse, w: Irony and Humour. From Pragmatics to Discourse, eds. L.R. Gurillo, M. Bel´en Alvaro Ortega, Amsterdam/Philadelphia: John Benjamins, 2013, s. 17–38.Skidelsky Robert, Only Connect: Biography and Truth, w: The Troubled Face of Biography, ed. E. Homberger, J. Charmley, New York: Macmillan, 1988, s. 1–16.Sperber Dan, DeirdreWilson, Ironia a rozróżnienie między użyciem a przywołaniem, przeł. M. B. Fedewicz, w: Ironia, red. M. Głowiński, Gdańsk: Słowo/obraz terytoria, 2002, s. 75–108.Stamirowska Krystyna, Bloomsbury i Virginia Woolf, w: Grupa Bloomsbury. Brytyjska bohema kręgu Virginii Woolf, Kraków: Międzynarodowe Centrum Kultury, 2010, s. 23–31.Storrm William, Irony and the Modern Theatre, Cambridge: CUP, 2011.Strachey Lytton, Eminent Victorians, New York: Garden City, 1918.Strachey Lytton, Ludzie epoki Wiktorii. Florence Nightingale. Generał Gordon, przeł. A. Pański, Warszawa: Towarzystwo Wydawnicze „Rój”, 1938.Tekcan Rana, The Biographer and the Subject: A Study of Biographical Distance, Stuttgart: ibidem–Verlag/ibidem Press, 2014.Walczuk Anna, Irony as a Mode of Perception and Principle of Ordering Reality in the Novels of Muriel Spark, Kraków: Universitas, 2005.Walter James, The Solace of Doubt? Biographical Methodology after the Short Twentieth Century, w: Theoretical Discussions of Biography: Approaches from History, Microhistory and Life Writing, eds. B. de Haan, Binnee, H. Renders, Leiden: Brill, 2014, s. 43–58.Wilde Alan, Modernism and the Aesthetic of Crisis, „Contemporary Literature” 1979, vol. 20, issue 1, s. 13–50.Wilde Alan, Horizons of Assent: Modernism, Postmodernism, and the Ironic Imagination, Baltimore: Johns Hopkins U. Press, 1987.1013715
Postural tachycardia syndrome among adolescents.
No full textPostural tachycardia syndrome (PoTS) is a polymorphic clinical syndrome that is underdiagnosed, especially in adolescents. It is a form of dysautonomia, but its exact physiopathology remains elusive. Several pathologies can mimic PoTS; it is characterized by heterogeneous symptoms that accompany a disproportionate tachycardia upon the upright position. It can significantly impact the patients' quality of life. Only a Schellong test is useful for making the diagnosis. Treatment in PoTS is primarily symptomatic with the main goal being to restore the patient's condition as quickly as possible. We report here the diagnosis and management of seven adolescents, aged 11-16, who have been followed up since 2015
PRESSURE BROADENING AND SHIFTS OF LINES IN THE 3- REGION
No full text1. M. A. H. Smith, C.P. Rinsland, V. Malathy Devi, D. Chirs Benner, and K. B. Thakur, J. Opt. Soc. Am. B, 5, 585-592(1998). 2. A. Barbe, S. Bouazza, and J. J. Plateaux, Appl. Opt., 30, 2431-2436(1991).Author Institution: Atmospheric Sciences Division, NASA Langley Research Center; Department of Physics The College of William and Mary, Williamsburg, VA 23187-8795; Department of Mathematics and Computer Science, Western Carolina UniversityWe have recorded high-resolution absorption spectra of ozone broadened by dry air, by or by using the McMath Fourier transform spectrometer at the National Solar Observatory on Kitt Peak. The spectra were recorded at room temperature, covering the region from approximately to at a resolution of . Broadening gas pressures varied from approximately 100 to 400 Torr. From these spectra we have determined pressure broadening and line shift coefficients for over 200 lines in the and 3 bands. The halfwidth values obtained in these bands are similar to those obtained in the and bands, indicating that there is little vibrational dependence of the Lorentz broadening coefficient for ozone broadened by air, or . However, the pressure line induced line shifts determined in the 3-m bands are larger than those observed in the m and m
- …
