1,721,074 research outputs found
PETANDA OLIGONULEOTIDA (ACTTAATTGGGAGCCATATA) BERLABEL BIOTIN UNTUK DETEKSI DINI KELAINAN GENETIK SPINDYLO-EPIPHYSEAL DYSPLASIA TARDA (SEDT) DI BENGKULU
No full textBAB I. PENDAHULUAN
No full textProteomic (dari kata proteome, PROTEin complement to genome)adalah teknik yang digunakan untuk memahami mekanisme fisiologi dan biokomia dengan membandingkan keberadaan protein-protein tertentu secara kualitatif dan kuantitatif yang berasal dari sel atau jaringan pada kondisi yang berbeda. Protein adalah produk gen yang fungsional, sehingga keberadaan protein akan lebih mencerminkan kondisi sebenarnya dari sel atau jaringan yang diisolasi. Oleh karena hasil transkripsi gen (mRNA) organism eukariot tidak langsung ditranslasikan menjadi protein, maka kondisi patologis atau toksitas tertentu lebih efektif dipelajari melalui perbedaan penampakan protein daripada mRNA (mRNA differential display)
PEMELIHARAAN HERPETOFAUNA LANGKA (Monouria emys DAN Heosemys spinosa) SEBAGAI SUMBER BELAJAR KONSERVASI EX SITU DI KEBUN BIOLOGI UNIVERSITAS BENGKULU
No full textIntegrating the Message of Turtle Conservation into a Science Teaching Plan for Elementary School in Bengkulu City, Indonesia
No full textThis research was aimed to develop a model of Science Teaching Plan (STP) to increase knowledge and appreciation of student about existing turtles. The model focused on fifth grade class of elementary school (SD), and duration of each STP was 80 minutes using eight live turtle specimens (D. subplana, A. cartilaginea M. emys, H. spinosa, N. platynota, C. odhamii, S. crassiocollis, and C. amboinensis) and printed materials. Posttest and attitude measurement were performed separately one week after completing the STP. Fifteen science teachers participated on the workshop to socialize the model, and then each of them implemented it at their classes which were involved the amount of 515 students. Quantitative data revealed that average score of pretest is 47.5 that means majority of students were not know well the reptiles. Achievements of the STP were calculated by gap between the both tests; it revealed that knowledge of students (63.8) about the matter increased (35.2%) significantly after the implementation. Meanwhile degree of appreciation concerning the existing turtles was 47.4 which classified as “excellent” and has a correlation (r=0.6) with the score of posttest. It can be concluded that the model can increase significantly the knowledge of SD students about the matter which is linked with the degree of their appreciation concerning the existing turtles
LAPORAN PENELITIAN UNGGULAN : PENGEMBANGAN POTENSI KULIT BATANG GAHARU (Aquilaria malaccensis) SEABAGAI PERANGSANG SEKS (Aphriodisiac) di Provinsi Bengkulu
No full textIndonesia dikenal sebagai Negara mega-biodeversity yang memiliki beranekaragam jenis organism yang tersebar diseluruh wilayah nusantara, sebagai contoh gaharu. Gaharu adalah sejenis kayu yang memiliki kadar dammar wangi (aromatic resin) sebagai akibat proses infeksi jamur. Gaharu digunakan untuk berbagai keperluan seperti parfum, pewangi ruangan, obat anti asmatik, penghilang rasa sakit, anti kanker, zat perangsang seks dan obat tumor paru-paru. Penelitian ini dilakukan dalam rangka mengembangkan pemanfaatan tanaman A malaccencis secara lebih produktif dengan mengisolasi senyawa stroid dari kulit batang untuk diuji potensinya sebagai zat penambah kebugaran dan aprhriodisiac senyawa stroid dalam kulit batang
Going Beyond Counting First Authors in Author Co-citation Analysis
Full text linkThe present study examines one of the fundamental aspects of author co-citation analysis (ACA) - the way co-citation
counts are defined. Co-citation counting provides the data on which all subsequent statistical analyses and mappings
are based, and we compare ACA results based on two different types of co-citation counting - the traditional type that
only counts the first one among a cited work's authors on the one hand and a non-traditional type that takes into
account the first 5 authors of a cited work on the other hand. Results indicate that the picture produced through this non-traditional author co-citation counting contains more coherent author groups and is therefore considerably clearer. However, this picture represents fewer specialties in the research field being studied than that produced through the traditional first-author co-citation counting when the same number of top-ranked authors is selected and analyzed. Reasons for these effects are discussed
Aklimasi Notochelys platynota yang akan dilepas di area target konservasi kura-kura Universitas Bengkulu
Full text linkABSTRACT[Acclimation Notochelys platynota That Will Be In Conservation In Area Ex Situ Bengkulu University]. The aim of this research is to know the effect of water pool in conservation target area to growth rate of N. platynota which will be released in conservation area of turtle of Bengkulu University. At the data collection stage, the pool water concentration is used P1: 100% pool water, P2: 75% pool water + 25% water well, P3: 50% pool water + 50% water well, P4: 25% pond water + 75% water Wells, P5: 100% well water. The data analyzed were weight growth rate, carapace length growth rate, growth rate of carapace width, body weight growth rate. The result is giving 100% of pool water in conservation target area of University of Bengkulu able to increas growth of N. Platynota.Keywords: Acclimation; N. platynota, Growth; Conservation Area; turtles.(Received November 19, 2018; Accepted April 15, 2019; Published June 18, 2019) ABSTRAKPenelitian ini bertujuan untuk mengetahui pengaruh pemberian air kolam di area target konservasi terhadap laju pertumbuhan N. platynota yang akan dilepas di area target konservasi kura-kura Universitas Bengkulu. Pada tahap pengumpulan data digunakan konsentrasi air kolam yaitu P1: 100 % air kolam, P2: 75% air kolam + 25% air sumur, P3: 50% air kolam + 50% air sumur, P4 : 25% air kolam + 75% air sumur, P5: 100% air sumur. Data yang dianalisis adalah laju pertumbuhan berat badan, laju pertumbuhan panjang karapaks, laju pertumbuhan lebar karapaks dan laju pertumbuhan tebal badan.. Hasil adalah pemberian 100% air kolam di area target konservasi Universitas Bengkulu mampu meningkatkan pertumbuhan N. Platynota.Kata kunci: Aklimasi; N. platynota; Pertumbuhan; Area Konservasi; kura-kura
Variations on the Author
Full text link“Variations on the Author” discusses two of Eduardo Coutinho’s recent films (Um Dia na Vida, from 2010, and Últimas Conversas, posthumously released in 2015) and their contribution to the general question of documentary authorship. The director’s filmography is characterized by a consistent yet self-effacing form of authorial self-inscription: Coutinho often features as an interviewer that rather than express opinions propels discourses; an interviewer that is good at listening. This mode of self-inscription characterizes him as an author who is not expressive but who is nonetheless markedly present on the screen. In Um Dia na Vida, however, Coutinho is completely absent form the image, while Últimas Conversas, on the contrary, includes a confessional prologue that moves the director from the margins to the center of his films. This article examines the ways in which these works stand out in the filmography of a director who offers new insights into the notion of cinematic authorship
- …
