1,721,155 research outputs found
The X-ray structural view of the complex between human alpha thrombin and a DNA aptamer directed to exosite II
No full textThe aim of anticoagulant/antithrombotic therapy in cardiovascular disease is to prevent fibrin
deposition and platelet aggregation, halting current and future ischemic episodes. The limitations to
the effectiveness of the most commonly used agents (heparin, coumadin and aspirin) have led to the
development of new anticoagulant compounds. In particular, aptamers represent an attractive
approach because of their high specificity and low immunogenicity. The best known example is the
Thrombin Binding Aptamer (TBA), namely 5‘GGTTGGTGT-GGTTGG3’[1]. TBA and its
derivatives [2] adopt a G-quadruplex structure [2-6] and inhibit thrombin activity by blocking the
fibrinogen binding site (exosite I) [3-6]. Biological properties of TBA are strictly dependent on its
tertiary structure. Other antithrombotic aptamers have been identified using the SELEX process and
partially characterized. Among them HD22, namely 5’GTCCGTGGTAGGGCAGGTTGGGGTGAC3’,
is particularly interesting. It presents a 15-nucleotide core sequence that has
striking similarity to TBA, and it has been reported to adopt a mixed duplex/quadruplex structure
[7]. Remarkably HD22 binds thrombin with much higher affinity than TBA and has been shown to
bind exosite II instead of exosite I [7]. No structural data on thrombin-HD22 complex has been
reported so far. We have solved the X-ray structure of the thrombin-HD22 complex, with the aim to
understand the molecular details of the interaction between the two molecules and to investigate the
differences with respect to thrombin-TBA complex, whose structure we have recently determined at
high resolution. These results could help the design of a new class of aptamers with an improved
capability to modulate thrombin function.
[1] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Nature, 355, 1992, 564.
[2] L. Martino, A. Virno, A. Randazzo, A. Virgilio, V. Esposito, C. Giancola, M. Bucci, G. Cirino, L. Mayol,
NAR, 34, 2006, 6653.
[3] R.F. Macaya, P. Schultze, F.W. Smith, J.A. Roe, J. Feigon, PNAS USA, 90, 1993, 3745.
[4] K. Padmanabhan, A. Tulinsky, Acta Crystallogr. D, 52, 1996, 272.
[5] I. Russo Krauss, A. Merlino, A. Randazzo, L. Mazzarella, F. Sica, Acta Crystallogr F, 66, 2010, 961.
[6] I. Russo Krauss, A. Merlino, C. Giancola, A. Randazzo, L. Mazzarella, F. Sica NAR, submitted
[7] D.M. Tasset, M.F. Kubik, W. Steiner, JMB, 272(5), 1997, 688
Structural characterization of the complex between alpha-thrombin and an exosite II specific aptamer
No full textAptamers are single-stranded DNA or RNA sequences able to recognize a wide variety of natural and synthetic targets including amino acids, peptides, proteins and even cells with high affinity and specificity [1]. They are considered a sort of nucleic acid version of antibodies with improved properties. Aptamers display a large number of structural arrangements, in particular the interesting G-quadruplex architecture that is adopted by many of them. Several cases have been also reported where aptamers are supposed to adopt a mixed duplex/quadruplex structure [1,2]. Interestingly, in every case, the presence of both structural motifs is needed for strong and specific binding of the target. Also potent second-generation thrombin aptamers adopt a duplex/quadruplex bimodular folding [2]. They have been proved to recognize thrombin exosite II [2], whereas best studied thrombin binding aptamers bind exosite I [3,4], and show very high affinity and specificity towards thrombin [2]. A sound model of these oligonucleotides, either free or in complex with thrombin, is not yet available. Here we present a structural study of one of these aptamers, HD22-27mer. Interestingly, the crystal structure of the aptamer in complex with thrombin displays a novel architecture, in which a double helical stem is enchained to a pseudo-G-quadruplex. Our results also underline the role of residues that join the duplex and the quadruplex motifs and control their recruitment in thrombin binding. Finally, our crystallographic model shed light on the contrasting circular dichroism studies reported in the literature [5], suggesting a major role of ions in determining the aptamer properties.
[1] B. Gatto, M. Palumbo, C. Sissi Current Medicinal Chemistry, 2009, 16, 1248-1265;
[2] D.M. Tasset, M.F. Kubik, W. Steiner Journal of Molecular Biology, 1997, 272(5), 688-698;.
[3] I. Russo Krauss, A. Merlino, C. Giancola, A. Randazzo, L. Mazzarella, F. Sica Nucleic Acids Res., 2011, 39(17), 7858–7867
[4] I. Russo Krauss, A. Merlino, A. Randazzo, E. Novellino, L. Mazzarella, F. Sica Nucleic Acids Res., 2012, 40(16), 8119-28
[5] G. Marson, M. Palumbo, C. Sissi Curr Pharm Des., 2012, 18(14), 2027-203
4-(2-amino-4-oxo-2-imidazolin-5-ylidene)-2-bromo-4,5,7,8-tetrahydropyrrolo-[2,3c]azepin-8-one methanol solvate: a new bromo compound from the sponge Acanhtella aurantiaca
No full textAutoinhibition of angiogenins: insights from the X-ray structure of RNase 2 from Atlantic salmon
No full textRecently, the superfamily of animal, extracellular, pyrimidine-specific RNases, often called the RNase
A superfamily, has been shown to include not only tetrapod enzymes, but also fish enzymes [1]. In
particular, five RNases from zebrafish (Danio rerio) [1-3] and two from the Atlantic salmon (Salmo
salar) [4] have been reported to have a very low RNase activity and to be endowed, like RNase 5
(human angiogenin), with powerful angiogenic activity. We have determined the X-ray structure of two
zebrafish RNases [3]. In these proteins, like in human angiogenin, the putative binding subsite B1 of the
pyrimidine base is partially obstructed by the side chain of Glu located in the C-terminal segment of the
protein, and this structural feature well account for their low catalytic activity.
More recently, the crystal structure of RNase-2 from Salmo salar (Ss2) has been also determined.
Surprisingly, within an essentially unmodified RNase folding, the enzyme presents an extensive
reorganization of the active site region with respect to other pancreatic RNases. In particular, although it
has the highest catalytic activity among fish RNases, it presents an active site fully obstructed by a
peptide segment at C-terminal region (CTR), and with the two catalytic histidines in direct contact. Thus
the enzyme appears to be auto-inhibited in a completely different manner compared to the other
angiogenins. Comparison of the structure of Ss2 with those of RNase complexes with substrate analogs
suggests that Ss2 could adopt two distinct conformations: a closed form with the CTR blocking the
substrate binding cleft (observed in the crystal structure) and an open conformation, where the CTR
swings out forming an open cleft with the active site exposed. Overall, these data provide novel
structural insights into the mechanism that modulates RNase activity of angiogenins.
[1] E. Pizzo, P. Buonanno, A. Di Maro, S. Ponticelli, S. De Falco, N. Quarto, M.V. Cubellis and G. D'Alessio, J Biol
Chem, 281, 2006, 27454.
[2] S. Cho and J. Zhang, Mol Biol Evol, 24, 2007, 1259.
[3] E. Pizzo, A. Merlino, M. Turano, I. Russo Krauss, F. Coscia, A. Zanfardino, M. Varcamonti, A. Furia, C.
Giancola, L. Mazzarella, F. Sica, G. D'Alessio, Biochem J., 433(2), 2010, 345
[4] E. Pizzo, M. Varcamonti, A. Di Maro, A. Zanfardino, C. Giancola, G. D'Alessio, FEBS J, 275, 2008, 1283
A new approach to assess drug sensitivity in cells for novel drug discovery
No full textThere is a pressing need to improve strategies to select candidate drugs early on in the drug development pipeline, especially in oncology, as the efficiency of new drug approval has steadily declined these past years. Traditional methods of drug screening have relied on low-cost assays on cancer cell lines growing on plastic dishes. Recent massive-scale screens have generated big data amenable for sophisticated computational modeling and integration with clinical data. However, 2D culturing has several intrinsic limitations and novel methodologies have been devised for culturing in three dimensions, to include cells from the tumor immune microenvironment. These major improvements are bringing in vitro systems even closer to a physiological, more clinically relevant state. Areas covered: In this article, the authors review the literature on methodologies for early-phase drug screening, focusing on in vitro systems and analyzing both novel experimental and statistical approaches. The article does not cover the expanding literature on in vivo systems. Expert opinion: The popularity of three-dimensional systems is exploding, driven by the development of 'organoid' derivation technology in 2009. These assays are growing in sophistication to accommodate the increasing need by modern oncology to develop drugs that target the microenvironment
Going Beyond Counting First Authors in Author Co-citation Analysis
Full text linkThe present study examines one of the fundamental aspects of author co-citation analysis (ACA) - the way co-citation
counts are defined. Co-citation counting provides the data on which all subsequent statistical analyses and mappings
are based, and we compare ACA results based on two different types of co-citation counting - the traditional type that
only counts the first one among a cited work's authors on the one hand and a non-traditional type that takes into
account the first 5 authors of a cited work on the other hand. Results indicate that the picture produced through this non-traditional author co-citation counting contains more coherent author groups and is therefore considerably clearer. However, this picture represents fewer specialties in the research field being studied than that produced through the traditional first-author co-citation counting when the same number of top-ranked authors is selected and analyzed. Reasons for these effects are discussed
Variations on the Author
Full text link“Variations on the Author” discusses two of Eduardo Coutinho’s recent films (Um Dia na Vida, from 2010, and Últimas Conversas, posthumously released in 2015) and their contribution to the general question of documentary authorship. The director’s filmography is characterized by a consistent yet self-effacing form of authorial self-inscription: Coutinho often features as an interviewer that rather than express opinions propels discourses; an interviewer that is good at listening. This mode of self-inscription characterizes him as an author who is not expressive but who is nonetheless markedly present on the screen. In Um Dia na Vida, however, Coutinho is completely absent form the image, while Últimas Conversas, on the contrary, includes a confessional prologue that moves the director from the margins to the center of his films. This article examines the ways in which these works stand out in the filmography of a director who offers new insights into the notion of cinematic authorship
- …
