663 research outputs found
Outpatient management of cancer-associated pulmonary embolism: A post-hoc analysis from the HOME-PE trial.
No full textpeer reviewedINTRODUCTION: Cancer-related pulmonary embolism (PE) is associated with poor prognosis. Some decision rules identifying patients eligible for home treatment categorize cancer patients at high risk of complications, precluding home treatment. We sought to assess the effectiveness and the safety of outpatient management of patients with low-risk cancer-associated PE. METHODS: In the HOME-PE trial, hemodynamically stable patients with symptomatic PE were randomized to either triaging with Hestia criteria or sPESI score. We analyzed 3 groups of low-risk PE patients: 47 with active cancer treated at home (group 1), 691 without active cancer treated at home (group 2), and 33 with active cancer as the only sPESI criterion qualifying them for hospitalization (group 3). The main outcome was the composite of recurrent venous thromboembolism, major bleeding, and all-cause death within 30 days after randomization. RESULTS: Patients treated at home had composite outcome rates of 4.3 % (2/47) for those with cancer vs. 1.0 % (7/691) for those without (odds ratio (OR) 4.98, 95%CI 1.15-21.49). Patients with cancer had rates of complications of 4.3 % when treated at home vs. 3.0 % (1/33) when hospitalized (OR 1.19, 95%CI 0.15-9.47). In multivariable analysis, active cancer was associated with an increased risk of complications for patients treated at home (OR 7.95; 95%CI 1.48-42.82). For patients with active cancer, home treatment was not associated with the primary outcome (OR 1.19, 95%CI 0.15-9.74). CONCLUSIONS: Among patients treated at home, active cancer was a risk factor for complications, but among patients with active cancer, home treatment was not associated with adverse outcomes
Can we improve the identification of cold homes for targeted home energy-efficiency improvements?
No full textObjective: To investigate the extent to which homes with low indoor-temperatures can be identified from dwelling and household characteristics.Design: Analysis of data from a national survey of dwellings, occupied by low-income households, scheduled for home energy-efficiency improvements. Setting: Five urban areas of England: Birmingham, Liverpool, Manchester, Newcastle and Southampton.Methods: Half-hourly living-room temperatures were recorded for two to four weeks in dwellings over the winter periods November to April 2001-2002 and 2002-2003. Regression of indoor on outdoor temperatures was used to identify cold-homes in which standardized daytime living-room and/ or nighttime bedroom-temperatures were < 16 degrees C (when the outdoor temperature was 5 degrees C). Tabulation and logistic regression were used to examine the extent to which these cold-homes can be identified from dwelling and household characteristics.Results: Overall, 21.0% of dwellings had standardized daytime living-room temperatures < 16 degrees C and 46.4% had standardized nighttime bedroom-temperatures below the same temperature. Standardized indoor-temperatures were influenced by a wide range of household and dwelling characteristics, but most strongly by the energy efficiency (SAP) rating and by standardized heating costs. However, even using these variables, along with other dwelling and household characteristics in a multi-variable prediction model, it would be necessary to target more than half of all dwellings in our sample to ensure at least 80% sensitivity for identifying dwellings with cold living-room temperatures. An even higher proportion would have to be targeted to ensure 80% sensitivity for identifying dwellings with cold-bedroom temperatures.Conclusion: Property and household characteristics provide only limited potential for identifying dwellings where winter indoor temperatures are likely to be low, presumably because of the multiple influences on home heating, including personal choice and behaviour. This suggests that the highly selective targeting of energy-efficiency programmes is difficult to achieve if the primary aim is to identify dwellings with cold-indoor-temperatures. (c) 2006 Published by Elsevier Ltd
Triaging acute pulmonary embolism for home treatment by Hestia or simplified PESI criteria: the HOME-PE randomized trial
No full textAIMS: The aim of this study is to compare the Hestia rule vs. the simplified Pulmonary Embolism Severity Index (sPESI) for triaging patients with acute pulmonary embolism (PE) for home treatment. METHODS AND RESULTS: Normotensive patients with PE of 26 hospitals from France, Belgium, the Netherlands, and Switzerland were randomized to either triaging with Hestia or sPESI. They were designated for home treatment if the triaging tool was negative and if the physician-in-charge, taking into account the patient's opinion, did not consider that hospitalization was required. The main outcomes were the 30-day composite of recurrent venous thrombo-embolism, major bleeding or all-cause death (non-inferiority analysis with 2.5% absolute risk difference as margin), and the rate of patients discharged home within 24 h after randomization (NCT02811237). From January 2017 through July 2019, 1975 patients were included. In the per-protocol population, the primary outcome occurred in 3.82% (34/891) in the Hestia arm and 3.57% (32/896) in the sPESI arm (P = 0.004 for non-inferiority). In the intention-to-treat population, 38.4% of the Hestia patients (378/984) were treated at home vs. 36.6% (361/986) of the sPESI patients (P = 0.41 for superiority), with a 30-day composite outcome rate of 1.33% (5/375) and 1.11% (4/359), respectively. No recurrent or fatal PE occurred in either home treatment arm. CONCLUSIONS: For triaging PE patients, the strategy based on the Hestia rule and the strategy based on sPESI had similar safety and effectiveness. With either tool complemented by the overruling of the physician-in-charge, more than a third of patients were treated at home with a low incidence of complications.SCOPUS: ar.jinfo:eu-repo/semantics/publishe
JOAO WANDERLEY GERALDI: THE LINGUIST RESEARCHER, TRAINING TEACHER AND UNIQUE BRAZILIAN READER OF BAKHTIN AND HIS STUDY CIRCLE
No full textThis article aims to honor and discuss our meeting with Joao Wanderley Geraldi, the linguist researcher, teacher trainer and unique reader of Bakhtin and his Study circle. Our subject matter in this paper is the meetings we held with the author in his research and teaching activities throughout his years of activism, and in specially during the Linguistics V program taken at Unicamp in 2005. From mediations with Geraldi on language studies, we chose to share our understanding of speech genres - involving life and education - that converge around this construction. Finally, we show how this knowledge guides us to maintain the inseparable relationship between language and literature in dialogue through a poem by Manoel de Barros, a poet who was also introduced to us by Geraldi.Univ Fed Santa Catarina UFSC, Programa Posgrad Linguist PPGL UFSC, Florianopolis, BrazilUniv Fed Santa Catarina, GEBAP Grp Estudos Bakhtinianos Pampa, Nucleo Estudos & Pesquisas Alfabetizacao & Ensino, Florianopolis, BrazilUniv Fed Santa Catarina, NEPALP, Nucleo Estudos & Pesquisas Alfabetizacao & Ensino, Florianopolis, BrazilNELA UFSC, Nucleo Estudos Linguist Aplicada, Florianopolis, BrazilGrp UNESP, Grp Estudos Alfabetizacao Brasil, Sao Paulo, BrazilUNIPAMPA Univ Fed Pampa, Curso Letras Linguas Adicionais, Campus Bage, RS, BrazilGEBAP Grp Estudos Bakhtinianos Pampa, Bage, BrazilGrp UNESP, Grp Estudos Alfabetizacao Brasil, Sao Paulo, Brazi
Cardiopulmonary resuscitation in adults over 80 : outcome and the perception of appropriateness by clinicians
No full textAbstract: OBJECTIVES To determine the prevalence of clinician perception of inappropriate cardiopulmonary resuscitation (CPR) regarding the last out-of-hospital cardiac arrest (OHCA) encountered in an adult 80 years or older and its relationship to patient outcome. DESIGN Subanalysis of an international multicenter cross-sectional survey (REAPPROPRIATE). SETTING Out-of-hospital CPR attempts registered in Europe, Israel, Japan, and the United States in adults 80 years or older. PARTICIPANTS A total of 611 clinicians of whom 176 (28.8%) were doctors, 123 (20.1%) were nurses, and 312 (51.1%) were emergency medical technicians/paramedics. RESULTS AND MEASUREMENTS The last CPR attempt among patients 80 years or older was perceived as appropriate by 320 (52.4%) of the clinicians; 178 (29.1%) were uncertain about the appropriateness, and 113 (18.5%) perceived the CPR attempt as inappropriate. The survival to hospital discharge for the "appropriate" subgroup was 8 of 265 (3.0%), 1 of 164 (.6%) in the "uncertain" subgroup, and 2 of 107 (1.9%) in the "inappropriate" subgroup (P = .23); 503 of 564 (89.2%) CPR attempts involved non-shockable rhythms. CPR attempts in nursing homes accounted for 124 of 590 (21.0%) of the patients and were perceived as appropriate by 44 (35.5%) of the clinicians; 45 (36.3%) were uncertain about the appropriateness; and 35 (28.2%) perceived the CPR attempt as inappropriate. The survival to hospital discharge for the nursing home patients was 0 of 107 (0%); 104 of 111 (93.7%) CPR attempts involved non-shockable rhythms. Overall, 36 of 543 (6.6%) CPR attempts were undertaken despite a known written do not attempt resuscitation decision; 14 of 36 (38.9%) clinicians considered this appropriate, 9 of 36 (25.0%) were uncertain about its appropriateness, and 13 of 36 (36.1%) considered this inappropriate. CONCLUSION Our findings show that despite generally poor outcomes for older patients undergoing CPR, many emergency clinicians do not consider these attempts at resuscitation to be inappropriate. A professional and societal debate is urgently needed to ensure that first we do not harm older patients by futile CPR attempts
Long-term safety and efficacy of subcutaneous immunoglobulin IgPro20 in CIDP PATH extension study
No full textObjective To investigate the long-term safety and efficacy of weekly subcutaneous IgPro20 (Hizentra, CSL Behring) in chronic inflammatory demyelinating polyneuropathy (CIDP). Methods In a 48-week open-label prospective extension study to the PATH study, patients were initially started on 0.2 g/kg or on 0.4 g/kg weekly and-if clinically stable-switched to 0.2 g/kg weekly after 24 weeks. Upon CIDP relapse on the 0.2 g/kg dose, 0.4 g/kg was (re)initiated. CIDP relapse was defined as a deterioration by at least 1 point in the total adjusted Inflammatory Neuropathy Cause and Treatment score. Results Eighty-two patients were enrolled. Sixty-two patients initially received 0.4 g/kg, 20 patients 0.2 g/kg weekly. Seventy-two received both doses during the study. Sixty-six patients (81%) completed the 48-week study duration. Overall relapse rates were 10% in 0.4 g/kg-treated patients and 48% in 0.2 g/kg-treated patients. After dose reduction from 0.4 to 0.2 g/kg, 51% (27/53) of patients relapsed, of whom 92% (24 of 26) improved after reinitiation of the 0.4 g/kg dose. Two-thirds of patients (19/28) who completed the PATH study without relapse remained relapse-free on the 0.2 g/kg dose after dose reduction in the extension study. Sixty-two patients had adverse events (AEs) (76%), of which most were mild or moderate with no related serious AEs. Conclusions Subcutaneous treatment with IgPro20 provided long-term benefit at both 0.4 and 0.2 g/kg weekly doses with lower relapse rates on the higher dose. Long-term dosing should be individualized to find the most appropriate dose in a given patient. Classification of evidence This study provides Class IV evidence that for patients with CIDP, long-term treatment with SCIG beyond 24 weeks is safe and efficacious.Peer reviewe
Analysis of Waveform-Derived ORA Parameters in Early Forms of Keratoconus and Normal Corneas
No full textPURPOSE: To evaluate the Ocular Response Analyzer (ORA; Reichert Ophthalmic Instruments, Depew, NY) performance in differentiating grades I and II keratoconus from normal corneas using 41 parameters individually and to assess the effect of analyzing all parameters together.METHODS: This study compared the mean value of 41 ORA parameters in grades I and II keratoconus with healthy age-matched control eyes. Only eyes with a central corneal thickness between 500 and 600 mu m were included. the area under the receiver operating characteristic curve was calculated for each of the 41 parameters independently and for all of the parameters together.RESULTS: This study included 136 eyes with normal corneas and 68 eyes with grades I and II keratoconus. When analyzed individually, four ORA parameters (p1area, p1area1, p2area, and p2area1) had an area under the curve greater than 0.900 for discriminating between both groups. the p2area was the parameter that achieved the largest area under the curve individually (0.931). the area under the curve increased to 0.978 when analyzing all parameters together.CONCLUSION: Alternative ORA parameters are better for differentiating grades I and II keratoconus from normal corneas than the four parameters originally available for ophthalmologists (corneal hysteresis, Goldmann-correlated intraocular pressure, corneal-compensated intraocular pressure, and corneal resistance factor). Although the ORA did not achieve 100% accuracy, the discrimination between these two groups was optimized by combining all parameters.Brazilian Study Grp Artificial Intelligence & Cor, Rio de Janeiro, BrazilAltino Ventura Fdn, Recife, PE, BrazilUniv Fed Alagoas, Maceio, BrazilInst Olhos Renato Ambrosio, Rio de Janeiro, BrazilUniversidade Federal de São Paulo, São Paulo, BrazilUniv Ciencias Saude Alagoas, Maceio, BrazilUniversidade Federal de São Paulo, EPM, São Paulo, BrazilWeb of Scienc
Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.
No full textThe transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.
To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.
Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).
Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.
Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation
Accuracy of the Adaptive GRP Scheme and the Simulation of 2-D Riemann Problems for Compressible Euler Equations
No full textThe adaptive generalized Riemann problem (GRP) scheme for 2-D compressible fluid flows has been proposed in [J. Comput. Phys., 229 (2010), 1448-1466] and it displays the capability in overcoming difficulties such as the start-up error for a single shock, and the numerical instability of the almost stationary shock. In this paper, we will provide the accuracy study and particularly show the performance in simulating 2-D complex wave configurations formulated with the 2-D Riemann problems for compressible Euler equations. For this purpose, we will first review the GRP scheme briefly when combined with the adaptive moving mesh technique and consider the accuracy of the adaptive GRP scheme via the comparison with the explicit formulae of analytic solutions of planar rarefaction waves, planar shock waves, the collapse problem of a wedge-shaped dam and the spiral formation problem. Then we simulate the full set of wave configurations in the 2-D four-wave Riemann problems for compressible Euler equations [SIAM J. Math. Anal., 21 (1990), 593-630], including the interactions of strong shocks (shock reflections), vortex-vortex and shock-vortex etc. This study combines the theoretical results with the numerical simulations, and thus demonstrates what Ami Harten observed "for computational scientists there are two kinds of truth: the truth that you prove, and the truth you see when you compute" [J. Sci. Comput., 31 (2007), 185-193].http://gateway.webofknowledge.com/gateway/Gateway.cgi?GWVersion=2&SrcApp=PARTNER_APP&SrcAuth=LinksAMR&KeyUT=WOS:000298763800002&DestLinkType=FullRecord&DestApp=ALL_WOS&UsrCustomerID=8e1609b174ce4e31116a60747a720701Physics, MathematicalSCI(E)16ARTICLE3577-6061
- …
