1,279 research outputs found
Relationships between gastric motility and gastric vagal afferent responses to CCK and GRP in rats differ
The brain-gut peptides cholecystokinin (CCK) and the mammalian bombesin-like peptide gastrin-releasing peptide (GRP) suppress food intake. Vagotomy blocks CCK- but not bombesin (BN)-induced feeding suppression, demonstrating differential vagal contributions. We examined the relationship between the ability of CCK and the active fragment of GRP, GRP-(18-27), to stimulate gastric vagal afferent activity and their ability to elicit changes in gastric motility. We also examined ligated cervical vagal segments and revealed specific 125I-CCK vagal binding without evidence of radiolabeled BN binding sites. Both close arterial and intraperitoneal CCK and GRP-(18-27) produced dose-dependent increases in activity in gastric vagal mechanoreceptive afferents. CCK dose dependently decreased gastric pressure without altering antral wall tension, whereas GRP-(18-27) dose dependently increased both gastric pressure and peak antral wall muscle tension. These results suggest that GRP-(18-27) activates gastric vagal afferents secondary to its stimulation of gastric motor effects. CCK activates this same population of vagal afferents independent of changes in gastric tension, suggesting a direct action of CCK at functional vagal CCK receptors. </jats:p
Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.
The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.
To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.
Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).
Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.
Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation
GRPR (Gastrin-Releasing Peptide Receptor)
Bombesin (BB) and gastrin-releasing peptide (GRP) bind with high affinity to the GRP-receptor (GRP-R) which regulates release of gastrointestinal hormones, smooth muscle contraction and proliferation of epithelial as well as cancer cells. The GRP-R is a G-protein coupled receptor (GPCR) which activates phospholipase C signaling pathways. The GRP-R is expressed in numerous cancers including breast, colon, lung and prostate cancer
Hypocretin/orexin preferentially activates caudomedial ventral tegmental area dopamine neurons
The hypocretin/orexin (HCRT) neuropeptide system modulates behavioral state and state‐dependent processes via actions on multiple neuromodulatory transmitter systems. Recent studies indicate that HCRT selectively increases dopamine (DA) neurotransmission within the prefrontal cortex (PFC) and the shell subregion of the nucleus accumbens (NAs), but not the core subregion of the nucleus accumbens (NAc). The circuitry underlying the differential actions of HCRT across distinct DA systems is unclear. The current study examined whether HCRT preferentially activates PFC‐ and NAs‐projecting relative to NAc‐projecting DA neurons within the VTA. One week after infusion of the retrograde tracer fluorogold (FG) into the medial PFC, NAc or NAs, animals received a ventricular infusion of HCRT‐1. Subsequent analyses conducted across the rostral‐caudal extent of the VTA determined the degree to which: (i) Fos‐immunoreactivity (ir) was observed within tyrosine hydroxylase (TH)‐ir neurons; (ii) TH‐ir was observed within FG‐ir neurons; and (iii) Fos‐ir was observed within FG‐ir neurons. HCRT significantly increased Fos‐ir in VTA DA (TH‐ir) neurons, primarily in a restricted population of small‐to‐medium‐sized DA neurons located within the caudomedial VTA. Furthermore, within this region of the VTA, PFC‐ and NAs‐projecting TH‐ir neurons were more likely to contain Fos‐ir than were NAc‐projecting TH‐ir neurons. These results provide novel evidence that HCRT selectively activates PFC‐ and NAs‐projecting DA neurons within the VTA, and suggest a potential role for HCRT in PFC‐ and NAs‐dependent cognitive and/or affective processes. Moreover, these and other observations suggest that the dysregulation of HCRT–DA interactions could contribute to cognitive/affective dysfunction associated with a variety of behavioral disorders.Peer reviewedFinal article publisheddopaminehypocretinnucleus accumbensorexinprefrontal cortexventral tegmental are
Leucyl-tRNA Synthetase Activates Vps34 in Amino Acid-Sensing mTORC1 Signaling
SummaryAmino acid availability activates signaling by the mammalian target of rapamycin (mTOR) complex 1, mTORC1, a master regulator of cell growth. The class III PI-3-kinase Vps34 mediates amino acid signaling to mTORC1 by regulating lysosomal translocation and activation of the phospholipase PLD1. Here, we identify leucyl-tRNA synthetase (LRS) as a leucine sensor for the activation of Vps34-PLD1 upstream of mTORC1. LRS is necessary for amino acid-induced Vps34 activation, cellular PI(3)P level increase, PLD1 activation, and PLD1 lysosomal translocation. Leucine binding, but not tRNA charging activity of LRS, is required for this regulation. Moreover, LRS physically interacts with Vps34 in amino acid-stimulatable non-autophagic complexes. Finally, purified LRS protein activates Vps34 kinase in vitro in a leucine-dependent manner. Collectively, our findings provide compelling evidence for a direct role of LRS in amino acid activation of Vps34 via a non-canonical mechanism and fill a gap in the amino acid-sensing mTORC1 signaling network
VEGF activates receptor-operated cation channels in human microvascular endothelial cells
Role: Joint senior/corresponding author (co-wrote grant and paper; all electrophysiology conducted in my laboratory). Importance: First characterisation of the ion channels mediating cation entry into human microvascular endothelial cells in response to Vascular Endothelial Growth Factor (VEGF). Shows channels to have TRP-like characteristics and that VEGF activates recombinant TRPC3/C6 channels.Role: Joint senior/corresponding author (co-wrote grant and paper; all electrophysiology conducted in my laboratory). Importance: First characterisation of the ion channels mediating cation entry into human microvascular endothelial cells in response to Vascular Endothelial Growth Factor (VEGF). Shows channels to have TRP-like characteristics and that VEGF activates recombinant TRPC3/C6 channels
GRP and NMB directly bind to BRS3 in nonplacental vertebrates in high affinity via Gq signaling, whereas BRS3 in placental mammals constitutively activates two novel G protein–signaling Gs and G12.
(A) Binding of GRP and NMB to BRS3 receptors in nonplacental vertebrates. (B) Comparison of binding affinity of GRP/NMB to BRS3, GRPR, and NMBR receptors. “-” indicates not detected. Values represent IC50 expressing as mean ± SE for at least three independent experiments. (C) YM 254890 inhibits the phosphorylation levels of ERK for BRS3 receptors in nonplacental vertebrates. Receptor-expressing HEK293 cells were pretreated with inhibitor for 1 h with 25 μM. Subsequently, GRP or NMB peptides were added to the cells at a concentration of 1 μM for 5 min before western blot. (D) YM 254890 inhibits Ca2+ ion levels in cells transfected with BRS3 receptors of nonplacental vertebrates. Receptor-expressing HEK293 cells were pretreated with inhibitor for 1 h with 25 μM. Subsequently, GRP or NMB were added to the cells at a concentration of 10 nM prior to the assay. The calcium fold is calculated by fluorescence intensity (excitation/emission wavelength: 490/520 nm). (E) YM 254890 inhibits the constitutively activated Gq signaling pathway with BRS3 of placental mammals. Receptor-expressing HEK293 cells were pretreated with 25 μM inhibitor for 12 h prior to the luciferase assays. (F) Constitutive activity for each BRS3 mutants in placental mammals. Statistical significance was defined as a P value P value S2 Data. aBRS3, aardvark BRS3; BRS3, bombesin receptor subtype-3; cBRS3, chicken BRS3; CRE, cAMP response element; ERK, extracellular signal–regulated kinase; GRP, gastrin-releasing peptide; GRPR, GRP receptor; hBRS3, human BRS33; HEK293, human embryonic kidney 293; mBRS3, mouse BRS3; NFAT, nuclear factor of activated T cells; NMB, neuromedin B; NMBR, NMB receptor; pERK, phosphorylated ERK; sBRS3, spotted gar BRS3; SRF, serum response factor; tBRS3, turtle BRS3.</p
T-bet Activates Th1 Genes through Mediator and the Super Elongation Complex
The transcription factor T-bet directs Th1 cell differentiation, but the molecular mechanisms that underlie this lineage-specific gene regulation are not completely understood. Here, we show that T-bet acts through enhancers to allow the recruitment of Mediator and P-TEFb in the form of the super elongation complex (SEC). Th1 genes are occupied by H3K4me3 and RNA polymerase II in Th2 cells, while T-bet-mediated recruitment of P-TEFb in Th1 cells activates transcriptional elongation. P-TEFb is recruited to both genes and enhancers, where it activates enhancer RNA transcription. P-TEFb inhibition and Mediator and SEC knockdown selectively block activation of T-bet target genes, and P-TEFb inhibition abrogates Th1-associated experimental autoimmune uveitis. T-bet activity is independent of changes in NF-κB RelA and Brd4 binding, with T-bet- and NF-κB-mediated pathways instead converging to allow P-TEFb recruitment. These data provide insight into the mechanism through which lineage-specifying factors promote differentiation of alternative T cell fates
Broccoli-Derived Glucoraphanin Activates AMPK/PGC1α/NRF2 Pathway and Ameliorates Dextran-Sulphate-Sodium-Induced Colitis in Mice
As the prevalence of inflammatory bowel diseases (IBD) rises, the etiology of IBD draws increasing attention. Glucoraphanin (GRP), enriched in cruciferous vegetables, is a precursor of sulforaphane, known to have anti-inflammatory and antioxidative effects. We hypothesized that dietary GRP supplementation can prevent mitochondrial dysfunction and oxidative stress in an acute colitis mouse model induced by dextran sulfate sodium (DSS). Eight-week-old mice were fed a regular rodent diet either supplemented with or without GRP. After 4 weeks of dietary treatments, half of the mice within each dietary group were subjected to 2.5% DSS treatment to induce colitis. Dietary GRP decreased DSS-induced body weight loss, disease activity index, and colon shortening. Glucoraphanin supplementation protected the colonic histological structure, suppressed inflammatory cytokines, interleukin (IL)-1β, IL-18, and tumor necrosis factor-α (TNF-α), and reduced macrophage infiltration in colonic tissues. Consistently, dietary GRP activated AMP-activated protein kinase (AMPK), peroxisome proliferator-activated receptor-gamma coactivator (PGC)-1α, and nuclear factor erythroid 2-related factor 2 (NRF2) pathways in the colonic tissues of DSS-treated mice, which was associated with increased mitochondrial DNA and decreased content of the oxidative product 8-hydroxydeoxyguanosine (8-OHDG), a nucleotide oxidative product of DNA. In conclusion, dietary GRP attenuated mitochondrial dysfunction, inflammatory response, and oxidative stress induced by DSS, suggesting that dietary GRP provides a dietary strategy to alleviate IBD symptoms
Transcription factor 8 activates R-Ras to regulate angiogenesis
We have recently reported that transcription factor 8 (TCF8) negatively regulates pathological angiogenesis by regulating endothelial invasiveness by acting as a transcriptional attenuator of matrix metalloproteinase 1. TCF8 also modulates cell–matrix and cell–cell adhesion; however molecular mechanism of this TCF8 function remains obscure. Here, we provide evidence that TCF8 activates R-Ras, another class of angiogenic regulator, to suppress angiogenesis by a mechanism other than a transcriptional attenuator. Tube formation by human umbilical vein endothelial cells (HUVECs) facilitated by TCF8 suppression was significantly inhibited by the expression of onstitutive active mutant of R-Ras. When we examined the mRNA expression levels of R-Ras regulators, no significant changes were observed to explain the R-Ras activation by TCF8. Interestingly, we found that TCF8 bound to CalDAG-GEFIII, an R-Ras activator, in the cytosol, indicating that TCF8 emanates signaling for R-Ras activation from cytosol to regulate angiogenesis negatively
- …
