205 research outputs found
Erwin Strittmatter in reference to the agarian novel of the nineteenth and twentieth centuries
This study deals with two aspects of German literature: the agrarian novel from the early nineteenth century to National Socialism, and a comparison of capitalist and socialist ideology, using the works of the DDR author Erwin Strittmatter.
In the first part of the thesis, chosen works are analysed with the aim of establishing a pattern of bourgeois idealism and of tracing its development in reference to the changing historical background. The political implications of the nationalist transformation and radicalisation of the conservative agrarian ideology, which grew up as a middle-class reaction to the emergence of modern industrial Germany, are illustrated by the combination of the heroic and the idyllic in fascist literature.
The second part deals with the socialist agrarian novel, which is discussed, in the light of Marxist theory, as a departure from the conservative model, and in relation to different political ideals and objectives. Three agrarian novels of Erwin Strittmatter Ochsenkutscher, Tinko and Ole Bienkopp - are examined in detail as the basis for contrast with capitalist doctrine and for observations on the role of literature in the DDR.
The concluding chapter illustrates how, in the established East German state of the 1960's, the disregard for the demands of authority, which is a feature of Strittmatter's Ole Bienkopp, indicates a return to the traditional pattern of bourgeois idealism within the confines of socialist morality
Genome sequence of Desulfobacterium autotrophicum HRM2, a marine sulfate reducer oxidizing organic carbon completely to carbon dioxide
Strittmatter AW, Liesegang H, Rabus R, et al. Genome sequence of Desulfobacterium autotrophicum HRM2, a marine sulfate reducer oxidizing organic carbon completely to carbon dioxide. ENVIRONMENTAL MICROBIOLOGY. 2009;11(5):1038-1055.Sulfate-reducing bacteria (SRB) belonging to the metabolically versatile Desulfobacteriaceae are abundant in marine sediments and contribute to the global carbon cycle by complete oxidation of organic compounds. Desulfobacterium autotrophicum HRM2 is the first member of this ecophysiologically important group with a now available genome sequence. With 5.6 megabasepairs (Mbp) the genome of Db. autotrophicum HRM2 is about 2 Mbp larger than the sequenced genomes of other sulfate reducers (SRB). A high number of genome plasticity elements (> 100 transposon-related genes), several regions of GC discontinuity and a high number of repetitive elements (132 paralogous genes Mbp(-1)) point to a different genome evolution when comparing with Desulfovibrio spp. The metabolic versatility of Db. autotrophicum HRM2 is reflected in the presence of genes for the degradation of a variety of organic compounds including long-chain fatty acids and for the Wood-Ljungdahl pathway, which enables the organism to completely oxidize acetyl-CoA to CO2 but also to grow chemolithoautotrophically. The presence of more than 250 proteins of the sensory/regulatory protein families should enable Db. autotrophicum HRM2 to efficiently adapt to changing environmental conditions. Genes encoding periplasmic or cytoplasmic hydrogenases and formate dehydrogenases have been detected as well as genes for the transmembrane TpII-c(3), Hme and Rnf complexes. Genes for subunits A, B, C and D as well as for the proposed novel subunits L and F of the heterodisulfide reductases are present. This enzyme is involved in energy conservation in methanoarchaea and it is speculated that it exhibits a similar function in the process of dissimilatory sulfate reduction in Db. autotrophicum HRM2
Evaluation of the online-course "Leistungsbeurteilung und Lernmotivation"
Im Rahmen des vom Bundesministerium für Bildung und Forschung finanzierten Projektes "Multimediagestütztes Lehren im Hochschulbereich — Möglichkeiten in der Lehrerausbildung" wurde in der Fachrichtung Erziehungswissenschaft das Online-Seminar "Leistungsbeurtei-lung und Lernmotivation" entwickelt. Um einerseits den reibungslosen Start des Online-Seminars zu gewährleisten und um andererseits auch einen Eindruck von der allgemeinen Akzeptanz dieser Seminarform zu gewinnen, haben wir eine Evaluation in Auftrag gegeben. Gegenstand dieser Untersuchung war eine Demoversion des Internetseminars, die unter http://virtual-teacher.ezw.uni-saarland.de:70/courses verfügbar ist.Within the framework of the project "Multimediagestütztes Lehren im Hochschulbereich — Möglichkeiten in der Lehrerausbildung" financed by the Federal Ministry of Education and Research, the department of educational studies has developed the online seminar entitled "Leistungsbeurteilung und Lernmotivation". In order to ensure that the online seminar gets underway without any hitches and to get a general impression of how this form of seminar is received, we commissioned an evaluation. The subject of this study was a demo version of the internet seminar, available under http://virtual-teacher.ezw.uni-saarland.de:70/courses
Eva Strittmatter zum 80. Geburtstag. Ihre unveröffentlichten Gedichte in einem Band [Eva Strittmatter: Wildbirnenbaum. Gedichte. Berlin: Aufbau, 2009]
Silodosin: pharmacological and clinical features
Benign prostatic hyperplasia is one of the most common diseases of elderly men and is often, but not exclusively, associated with lower urinary tract symptoms. The primary aim of therapy is to improve lower urinary tract symptoms and quality of life and, second, to prevent complications, such as urinary retention, upper urinary tract dilatation and infection. α1-blockers are used as first-line therapy. Today, there are different α-blockers available. They have comparable clinical effectiveness; however, they differ in their tolerability profiles. The α1A-receptor selectivity may be one reason for the difference in the tolerability profile. A new very selective α1A-blocker, named silodosin, is now available in Europe. This article gives an overview of the chemical structure of silodosin, its pharmacokinetics, metabolism, interaction with other drugs and pharmacodynamics. In the second half of this article, the clinical efficacy of silodosin and its adverse events are highlighted and compared with other available α1-blockers. </jats:p
Nachrichten aus einem umstrittenen Leben. Neues von und über Erwin Strittmatter [Annette Leo: Erwin Strittmatter. Die Biographie. Berlin: Aufbau, 2012; Erwin Strittmatter: Nachrichten aus meinem Leben. Aus den Tagebüchern 1954-1973. Berlin: Aufbau, 2012]
Genome sequence of the bioplastic-producing ‘‘Knallgas’’ bacterium Ralstonia eutropha H16
The H2-oxidizing lithoautotrophic bacterium Ralstonia eutropha H16 is a metabolically versatile organism capable of subsisting, in the absence of organic growth substrates, on H2 and CO2 as its sole sources of energy and carbon. R. eutropha H16 first attracted biotechnological interest nearly 50 years ago with the realization that the organism’s ability to produce and store large amounts of poly[R-(–)-3-hydroxybutyrate] and other polyesters could be harnessed to make biodegradable plastics. Here we report the complete genome sequence of the two chromosomes of R. eutropha H16. Together, chromosome 1 (4,052,032 base pairs (bp)) and chromosome 2 (2,912,490 bp) encode 6,116 putative genes. Analysis of the genome sequence offers the genetic basis for exploiting the biotechnological potential of this organism and provides insights into its remarkable metabolic versatility
Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.
The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.
To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.
Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).
Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.
Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation
- …
