Makara Journal of Health Research
Not a member yet
289 research outputs found
Sort by
Examination of Telomerase Expression with Immuno-Hystochemistry Techniques on Some of Cancer Cells
Background: Cancer is a disease that gets serious attention in the medical world. This is due to the ever increasing number of patients and there has been no effective way to treat. Cancer cells have telomerase activity is relatively high compared to normal cells, so the cancer cells have the ability to continue to proliferate. Cancer cells undergo uncontrolled mitosis and have high telomerase activity compared to cells normal. Telomerase is an enzyme responsible for telomere length, a segment of DNA that is the tip of chromosomes in eukaryotic cells. Telomeres are associated with the process of ageing and carcinogenesis. The purpose of this study was to determine the expression of telomerase in some cells such as breast cancer, cervical cancer, and lung cancer. Methods: The research method is experimental studies in several cancer cell cultures in the form of cell line. Cancer cells used were: HeLa (cervical cancer), MCF7 and T47D (breast cancer), WiDr (lung cancer), and Raji (lymphoma) with culture medium RPMI, DMEM, and M199. Vero cells is used (fibroblast cells) as a control (normal cells). Expression of telomerase enzyme was measured by the Immunohystochemistry (IHC) method. Results: The results showed that the cancer cells have activity/higher telomerase expression were highly significant (p<0.01) compared to normal cells (Vero cells). Similarly, the expression of telomerase in HeLa versus WiDr, WiDr versus T47D, T47D versus Raji, and Raji versus MCF7 also showed highly significant differences (p<0.01). Telomerase expression between cancer cells that showed significant difference (HeLa cells versus Raji cells; HeLa cells versus MCF7 cell; T47D cells versus MCF7 cells) (p<0.05). No significant difference was found in the group of HeLa cells versus T47D, WiDr versus Raji cells, and WiDr versus MCF7. Conclusions: It was concluded, that the cancer cells have telomerase expression of specific and different from each other, depending on the type of cell. T47D breast cancer cells have telomerase expression of the highest, followed by cervical cancer cells (HeLa). Lung cancer cells (WiDr) with cell lymphoma (Raji) has almost the same expression and both have lower expression
Human Center of Gravity Dynamics A New Parameter Of Motor Development Functions
A study of a new parameter of human growth and development was conducted. The percentage of the height of body gravity center to the stature in supine position was measured in males and females during the period of pre-puberty (l995), young and adult puberties (1995 and 1997) and male adults (1995). The parameters measured were weight, stature and the height of the gravity center. Data were calculated in obtaining arithmetic means, standard deviations of all parameters and the percentage of gravity point height to stature. The percentages of male and female means, as well as standard deviations, were compared statistically. It was shown that in the pre-puberty group the location of the gravity center to stature was the same in percentage in males compared to females, whereas in the adult group (1987, 1995) a higher percentage was found in males. Among males (1995) differences were found in the percentages, which might have been caused by differences of body typology; the mesomorphic type showed the highest percentage, the endomorphic type showed the lowest, whereas the ectomorphic type it was in between
A Comprehensive Study of Chronic Diabetes Complications in Streptozotocin-Induced Diabetic Rat
Background: The purpose of this study was to provide a reference of chronic diabetes complications by investigating the prolonged hyperglycemia effects on hematological, biochemical and histopathological changes (liver, kidney, spleen, cardiac muscle, adrenal gland, and endocrine pancreas) in diabetic rats induced by streptozotocin. Methods: Ten adult female Sprague-Dawley of uniform age were divided into two Groups. Group 1 was made diabetic by single intraperitoneal injection of streptozotocin (60 mg/kg/bw) whereas Group 2 served as control. After six months, the rats were anaesthetized using pentobarbital. Cardiac puncture was performed to get 3 ml of the blood sample; following 12 hours of an overnight fast. Serum chemistry test and complete blood analysis for lipid profile and blood glucose test; liver and renal functions were performed. Tissue specimens of liver, kidney, spleen, cardiac muscle, adrenal gland, and endocrine pancreas were fixed in 10% formal saline and processed for histological study. Results: There were severe histopathological changes in the affected organs; and the presence of a significant abnormality of lipid profile, liver, and renal functions. Conclusions: The presence of histopathological changes with abnormal biochemical changes is related to the chronic absence of insulin production in the destroyed β-cells which reflect the diabetic complications in a human being
Placental Morphology of Pregnant Iraqi Women with Rheumatic Heart Disease
Background: Placental morphology and cellular arrangement can be altered in maternal diseases. Rheumatic heart disease (RHD) is a chronic heart condition that can lead to death in pregnant women. The aim of this study is to determine the histological changes of the placenta in pregnant women suffering from RHD. Methods: Placentae were collected from 10 healthy pregnant women, and 31 pregnant women with heart conditions (26 with RHD and 5 with NRHD) who had been admitted to the Baghdad Teaching Hospital. Placental tissues were fixed in 10% formal-saline and were processed for light microscopy. Measurements including the placental weight and diameter of the chorionic villi capillaries were recorded. Results: The results indicate that there are many histological changes in pregnant women with RHD such as hyalinisation, fibrosis of the chorionic villi, proliferation of trophoblastic cells, and thickening of its membrane. Additionally, expectant mothers with RHD experience a reduction in capillary diameter and thickening of the capillary walls, and decreased size and weight of their placenta when compared with the control. Conclusions: Heart diseases, especially RHD, are associated with developmental damage of the placenta in pregnant women by injuring the endothelial cells of the placentas capillaries
Intestinal Helminthic Infections in School Children, Cibubur, East Jakarta
An integrated study was conducted on nutrition, physical examination and soil transmitted helminthes (S-TH) in four priminary schools in Cibubur, East Jakarta. In this report is shown data on prevalence and intensity of S-TH infections. Very low prevalences were found for Ascaris lumbricoides (0.0 – 1.6 %) and Trichuris trichiura (2.5 – 8.9 %). Also egg counts per gram (EPG) were very low. The prevalence and intensity rates were very low possibly due to factors such as self-medication, reguler health education and efforts of surrounding factories to improve the health of the community
Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction
Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia
Cephalometric Patterns on Javanese, Bataks and Chinese Students in Jakarta
In 2000 a cephalometric survey has been done on both genders of Javanese, Bataks and Chinese students at the University of Indonesia (UI), the Indonesian Christian University (UKI) and the Christian University of Jakarta (UKRIDA) with the aim to detect their cephalometric characteristics patterns and the degree of their secular changes with their ancestors. Cephalometric parameters were measured as follows: the maximal head length (glabellaopisthocranion), the maximal head breadth (euryon-euryon), the minimal forehead breadth (frontotemporalefrontotemporale), the morphological facial height (suborbitale-gnathion), the bizygomatic breadth (zygion-zygion) and the bi-gonion breadth (gonion gonion). In addition measurements were done on facial soft tissue factors such as the nasal height (suborbitale-subnasale) the nasal breadth (alare-alare), the ear length (superaurale-subaurale) and the ear breadth (preaurale-postaurale). The results were treated statistically using t test to obtain the degree of significance. It was determined that some cephalometric characteristics have undergone secular changes but both genders of Bataks, Javanese and Chinese students seemed to depict their retainment of their respective ancestors cephalometric characteristics, consequently their cephalometric characteristic differences were still detectable
The Prevalence and Risk Factors of GERD among Indonesian Medical Doctors
Background: Based on our knowledge, the study of gastrointestinal reflux disease (GERD) among certain profession has never been conducted. The aim of this study is to determine the prevalence and risk factors of GERD among Indonesian doctors. Methods: A consecutive study involving 515 doctors was conducted in October 2015. The GerdQ score was used to the diagnosis of GERD and determined its impact on daily life. All possible risk factors were also analysed. Results: A total of 515 subjects completed the questionnaire. The mean age of them was 41.37 ± 11.92 years old. Fifty-five percent of them were male and 60.6% general practitioners. The prevalence of GERD was 27.4% of which 21.0% was had GERD with low impact on daily life, and 6.4% was GERD with high impact on daily life. The statistically significant risk factors of GERD was found in age >50 y.o (p = 0.002; OR = 2.054), BMI >30 kg/m2 (p = 0.016; OR = 2.53), and smokers (p = 0.031; OR = 1.982). Sex and education level were not found significant statistically as the risk factors of GERD. Conclusions: The prevalence of GERD among Indonesian physician was 27.4%. We found that age over 50 y.o, obesity and smoking habit were the risk factors of GERD in Indonesian doctors. 
Challenges that Hinder Parturients to Deliver in Health Facilities: A Qualitative Analysis in Two Districts of Indonesia
Background: There are many challenges women face to be able to give birth in health facilities in many parts of Indonesia. This study explores the roles and observations of close-to-community maternal health providers and other community members on potential barriers faced by women to deliver in health facilities in two districts within The Archipelago. Methods: Employing an explorative qualitative approach, 110 semi-structured interviews and 7 focus group discussions were conducted in 8 villages in Southwest Sumba, in the East Nusa Tenggara province, and in 8 villages in Cianjur, in the West Java province. The participants included village midwives, Posyandu volunteer (village health volunteers), traditional birth attendants (TBAs), mothers, men, village heads and district health officials. Results: The main findings were mostly similar in the two study areas. However, there were some key differences. Preference for TBA care, traditional beliefs, a lack of responsiveness of health providers to local traditions, distance, cost of travel and indirect costs of accompanying family members were all barriers to patients attending health facilities for the birth of their child. TBAs were the preferred health providers in most cases due to their close proximity at the time of childbirth and their adherence to traditional practices during pregnancy and delivery. Conclusions: Improving collaborations between midwives and TBAs, collaboration, and responsiveness to traditional practices within health facilities and effective health promotion campaigns about the benefits of giving birth in health facilities may increase the use of health facilities in both study areas. 
Factor Influencing Gender Based Violence among Pregnant Women Attending Antenatal Clinic in PHC of Syangja District, Nepal
Pregnancy and childbirth were a time of unique vulnerability to violence victimization because of changes in women’s physical, social, emotional, and economic needs during pregnancy. This study aims to determine the factors associated with gender-based violence among pregnant women attending antenatal care clinic (ANC). A cross-sectional study was conducted among 202 pregnant women attend antenatal ward of primary health care centre (PHC) of Syangja district during September 2014 to December 2014 by using semi-structure questionnaire with face to face interviews. SPSS software was used for analysis the data. The prevalence of gender based violence (GBV) among pregnant women was found to be 91.1%. The socio-demographic variables such as ethnicity, religious, the age of respondents, the age of marriage, occupation, and annual income had no association with the experience of different types of GBV (p>0.05). However, there was a statistically association between husband education (p=0.03), the age of marriage (p=0.039) and type of marriage (p=0.013) in case of psychological and economic violence whereas there was no statistically association between with other types of violence. In conclusion, gender based violence during pregnancy was a major prevalent public health problem is Syangja district of Nepal. Focus on age of marriage, types of marriage and education of husband may reduce gender based violence among the pregnant women. Women’s empowerment, economic autonomy, sensitization, awareness and needed of large-scale population-based surveys were the major recommendation of this study