Makara Journal of Health Research
Not a member yet
289 research outputs found
Sort by
The Effect of Road Traffic Noise on Psychological Health Disorders of School Children at Cipinang Muara Elementary School, Jatinegara Sub District, East Jakarta City, DKI Jakarta Province, 2005
No full textThe traffic noise is the main issue of the community who live in urban area because it may cause an adverse human health and psychological effects. The purpose of this study is to describe the effect of road traffic noise to psychological health disorders on school children of Cipinang Muara elementary school at Jatinegara Sub District, and other risk factors such as distance, length of exposure, learning periode in school, and age. This research applied a case-control study with sample population of elementary school students from grade 4 to 6. Total samples were 240 children, including 80 cases and 160 controls. Data were collected through a multistage of random sampling. Data analysis used a computer program of univariate, bivariate and multivariate. Road traffic noise data measure in the classroom using noise logging dosimeter Q-400/500. Bivariate analysis (Chis-Square) and multiple logistic regression analysis are applied in the analysis. Bivariate analysis showed that there were a significantly effect of traffic noise, distance of seat, and length of exposure towards psychological health problems. On the other side, the length of school period and age of respondents did not have any significantly effect to the psychological health problems on the elementary school students. Multivariate analysis indicated that the elementary school students exposed to traffic noise more than 61.8 dBLAeq in the school area having a risk of psychological health problem 10.9 higher than those who were exposed to traffic noise less than 61.8 dBLAeq, a long with the distance variable and the length of noice exposure. It is required to socialize and apply the regulation on noise control and its impact in a consistently manner. Also, it is necessary to conduct health promotion and integrated monitoring both with inter-sector and inter-program. At last, to ensure the presence of inferential causal temporality, it is required to conduct further study with design of cohort or experimental study. This includes the increase of variable number and location of study in order to describe the real condition.  
The using of Spirulina platensis as Supplement of Single-Celled Protein (SCP) to Mice
No full textHigh protein in Spirulina platensis can be used as a source of Single-Celled Protein. By using mice (Mus musculus) as a animal laboratory, the objective of this research is to know the influence of Biomass S. platensis to the increase of body weight of mice. The name of species is Mus musculus, strain is Swiss derivate. Utilized mice were male, 30-50 weighing gram, and 5-7 weeks of age. Treatment group was given by palette and given by biomass of S. Platensis, while control also fed palette but did not give biomass of S. platensis. Yielded biomass was used as food mixed with palette with composition of dry biomass S. platensis with palette was 0%, 10%, 20%, 30%, 40%, and 50%. Data analysis was conducted by using t-tes and analysis of variance. The results showed that by giving of dry biomass of S. platensis affected to the increasement of body weight from the first day until twelfth day of observation, and decrease on the thirteenth and fourteenth day. Pursuant to result of statistic, there is a significant difference (p < 0,05) between before giving and after giving of dry biomass S. platensis during 17 day. By giving dry biomass of S. platensis to mice (Mus musculus) at first and second week, it was found the difference of average mice body weight among six concentrations of biomass but did not at the third week. It means that not all concentration of biomass have same effect to the increase of mice body weight as a Single-Celled Protein. 
Ground Water Filtration by Natural Zeolit to Reduce Iron and Manganese Levels
No full textGround Water Filtration by Natural Zeolit to Reduce Iron and Manganese Levels. In rural areas most people use ground water for their daily purposes. Frequently, the water has high levels of Fe dan Mn. To provide a simple, cheap and reliable apparatus to reduce Fe and Mn, a zeolit column has been designed for filtering ground water. The objective of this experiment was to establish the optimal condition of the filtration. Natural zeolit of Bayah origin was crushed and grounded into small particles of approximately 3 mm in diameter. After washed with distilled water and dried in open air, the particles were then packed in a 4 × 50-cm glass column. The zeolit column was installed vertically, watered with distilled water to compact, and dried. Then 500 mL of ground water sample was poured onto the prepared zeolit column. By adjusting the stopcock, the water samples were filtered off at a flowrate of 16 mL/min. Filtrateswere collected with interval of 30 minutes for 2.5 hours and subjected to Fe and Mn analysis. The experiment was repeated for filtration rates of 14, 12, 10, 8, 6, 4, and 2 mL/min. Fe and Mn concentrations, contact times, and flowrates were converted into scattered-plot graphs of contact times versus concentrations. The graphs show that the optimum condition for Fe and Mn removals were 30-minute contact time and 2-mL/minute flowrate. At this, the Bayah zeolit Fe was reduced for 55% but it was only 40% for Mn in ground water containing 3.6 mg/L Fe and 0.7 mg/L Mn. However, at the optimum condition water debit of the zeolit column was only 2.88 L/day. Quantitatively, with filtration rate of 2 mL/minute, up to 2.5 hours contact time the Fe was only reduced to as much 1.12 mg/L (standard: 1.0 mg/L) while the Mn reduced to nil. It was concluded that the Bayah zeolit was effective to reduce Fe and Mn in ground water, although reducing capacity for Mn was better than for Fe, whereas the column could not be applied for daily purposes due to its low water debit
The Physical, Chemical, and the Biological Stability Test on Liposome EPC-TEL 2.5 as the Newest Drug Delivery Systems (Drug Carrier), In Vitro and In Vivo
No full textThis experiment is carried out in order to improve the stability of the Liposome EPC-TEL 2.5 physically, chemically, and biologically. As a new formula, this liposome that has contained phosphatidylcholine from egg yolk=EPC and Tetra-ether Lipid (TEL) from membrane of Sulfolobus acidocaldarius or Thermoplasma acidophilum had never been tested on their stability. The stability of liposome to carry the drug into the targeted cells or organs is required for determining the therapeutic dose of the drugs. Physically, the test was done by measuring the amount and diameter of liposome after incubating at 4º C, at room temperature, and 37º C. Chemically, the test was also done using the same parameters after introduction of chemical solution of NaCl, CaCl2; MgCl2 at the pH of 5; 7; 9. The measurements was carried out on day 1; 7; and month 1; 2; and 3. Biologically, liposome EPC-TEL 2.5 was injected Intra-Peritoneally to mice to detect the degradation of TEL in their liver, at the minute of 0; 30 ; 60 ; the hour of 2; 4; and 8. The results of these tests were shown that liposome EPC-TEL 2.5 was stable until the last month of 1 at 4º C and 37º C on physical stability test; more stable at the chemical solution of NaCl and CaCl2 at the pH of 5 and 7 until two months; and TEL was degradable in liver of mice
Characterization of HIV RNA in Blood Donor Possessing Serological Test Indeterminate
No full textIndeterminate results of serological HIV test have been found in Indonesia. The screening procedure is following the prescribed by WHO for screening of blood donors which is based on 3 different serological HIV test during screening of blood donors. Discordant results are interpreted as indeterminate. In order to find the cause of the indeterminate results, we conducted RT-PCR detection of HIV RNA in samples from blood donors with indeterminate serological HIV-test. Plasma samples showing indeterminate results by serological testing from blood donor were collected from Blood Transfusion Service of Indonesian Red Cross and subjected to confirmatory test by using western blot. Test of 40 samples showed that 90% of the samples remain indeterminate. Most of the indeterminate results were caused by the reactivity towards p24 antigen. RT-PCR targeted at LTR, pol, env and p24 region of HIV was performed to detect the presence of HIV RNA. Primer were consequently designed to amplify these regions. Preliminary resµlts showed 1/35 24/32 (75%) positive LTR, 4/31 (12%) positive pol and 1/3 (33%) positive env. Amplification in p24 region showed that bands found have lower size than expected. Sequencing was performed to confirm these findings. The results suggest that further exploration should be performed in order to understand the magnitude of problem regarding HIV-RNA positivity in indeterminate sample by serological test to determine future direction such as the necessity to obtain information regarding the influence of circµlating HIV strain in Indonesian popµlation towards accuracy of HIV diagnostics. 
Bacteriocin Activity of Leuconostoc mesenteroides Pbac1 Bacteria on Several Media
No full textBacteriocin is a proteinaceous compound that has bactericidal action against microorganisms. Bacteriocins from lactic acid bacteria are very potential as natural food biopreservatives. The aim of the research was to know the infl uence of the growth medium; MRS, CMG, LTB and CM on antimicrobial activity of Leuconostoc mesenteroides Pbac1. Growth inhibition zone determination has been carried out by antagonism assay, as well as diffusion method using Lactobacillus plantarum, Leuconostoc mesenteroides, Staphylococcus aureus, Lactobacillus pentosus and Lactobacillus acidilactici as indicator strains. The results showed that L. plantarum and L. acidilactici were the sensitive indicators. The best growth medium for antagonism assay of the two sensitive indicator bacteria was MRS, which showed inhibition zone diameter of 1.28 cm and 1.23 cm, respectively. The most active supernatant was produced by L. mesenteroides Pbac1 grown on MRS, which inhibited the growth of L. plantarum and L. acidilactici with respective zone diameter of 1.28 cm and 1.19 cm. Bacteriocin titre activity against sensitive indicator bacteria was 100 AU/ml. Based on the result, MRS was further utilized to study the effect of the different carbon sources i.e glucose, maltose and mannose on bacteriocin activity of L. mesenteroides Pbac1. The results showed that glucose was the best carbon source as indicated by the widest diameter of inhibition zone, i.e 1.23 cm, against both indicator strains. Bacteriocin titre activity of the latter study was 100 AU/ml
Candida Isolation from Stools of HIV/AIDS Patients
No full textCandida is a saprophyte in the human respiratory tract, gastro intestinal tract and also in the debris under the nail. In patients with compromised immunity such as HIV-AIDS, Candida is able to cause infection, in this case oral candidosis or esophagitis. In this study fungi were isolated from the stools of HIV/AIDS patients. Samples consisting of 95 diarrheic stools from HIV/AIDS patients were investigated for the yeast especially Candida spp. The stools were inoculated onto Sabouraud dextrose agar then the fungi were identified using morphological methods and Chromagar medium. Yeast colonies were found in 71 (74,74%) out of 95 samples from which Candida was 42 (44,21%), Geotrichum 24 (25,26%), and mixed of Candida and Geotrichum 3 (3,16%), Rhodotorula and Trichosporon 1(1,05%) each. Species of Candida were identified as C. albicans, C. tropicalis, C. krusei, C. guilliermondii, C. glabrata, C. lusitaniae and C. kefyr. Although Candida could be isolated from the diarrheic stools of HIV/AIDS patients but its role on the cause of diarrhea is still questionable. 
The Elderly’s Coping to the Decrease of Musculosceletal Function at Kelurahan Cipinang Muara, Kecamatan Jatinegara, East Jakarta.
No full textThe elderly’s coping to the decrease of musculosceletal function at Kelurahan Cipinang Muara, Kecamatan Jatinegara, East Jakarta. The elderly naturally experiences the decrease of musculosceletal function as consequences of physical changes process. Frequently, these changes cause some disturbances like limited mobilization and their productivity. For some circumstances, it causes stressfull moment for them. These stressors motivate the elderly to adjust to the situation, which is named coping. The purpose of this study is to identify the coping strategy which is used by the elderly to cope with the decrese of musculosceletal function. This study conducted at RW 05, RW 08, and RW 11 at Kelurahan Cipinang Muara, Kecamatan Jatinegara, East Jakarta. The participants’ age range between 60-89 years old. Mostly are women (65.2%). Their marital status varied from married (52.17%), widows (41.30%), and widowers (6.52%). The questionnaire was developed using the ways of coping instrument by Folkman and Lazarus. These coping consist of confrontative, seeking social support, planful problem solving, self control, distancing, positive reappraisal, accepting responsibility, and escape/avoidance. The result shows that the participants used all those types of coping.The age does not determine the coping that they have been used. Most participants use adaptive coping, while the mal adaptive coping is used by 30.43% for self control; 13.04% for distancing; and 63.04% for escape/avoidance. In contrast, gender demonsrates the significant differences. Elderly female put a lot efforts to cope with their limited mobilization. They use confrontative(47.83%) and seeking social support (36.96%). Elderly male only use confrontative (21.7%) and seeking social support (36.96%)
Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain
No full textToxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang & Ho. Two methods described by Weiss et al and Chang & Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5’GGAACTGCATCCGTTCAGA G3’ and oligo 2 : 5’TCTTTAAAGCGTTCGTGGTC3’, whereas the P30 gene primers consisted of oligo 1 : 5’CACACGGTTGTATGTCGGTTTCG CT3’ and oligo 2 : 5’TCAAGG AGCTCAAT GTTACAGCCT3’. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang & Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target. 
Brachytherapy in the Treatment of Anorectal Cancer
No full textBrachytherapy in the Treatment of Anorectal Cancer. Nowadays in the treatment of malignant diseases, besides therapeutically results, the patient’s quality of life is considered very important and needs special attention. It is imperative to develop a therapy method that will yield results which gives more comfort to the patient, in particular concerning malignancies in organs with important functions and having cosmetic aspects. One modality, which can be used in special cases, that gives good results and good quality of life for the patient is brachytherapy. Brachytherapy is a method of radiotherapy by placing or inserting a radiation source in the target area in order to give a radiation dose enough to kill cancer cells but with a low dosage for the surrounding important organs. The use of brachytherapy has flourished by the findings of several radiation sources such as iridium, which can be implanted in several malignant locations. In anorectal malignancy, implantation and intracavity brachytherapy with or without external radiation give good results in saving the anal sphincter and its function