144 research outputs found

    DETEKSI BAKTERI Escherichia coli DALAM AIR MINUM ISI ULANG YANG DISTERILISASI ULTRAVIOLET DI WILAYAH KECAMATAN JAGAKARSA

    Get PDF
    Refill Water Depot is currently more widely circulated and used as an alternative drinking water supply by the public. However the still unclear about the quality of the drinking water refill generated primarily of biological content. Parameters of biological contamination in drinking water caused by the Escherichia coli and coliform bacterium. This study aims to identify E. coli and coliforms in drinking water refill. Refill drinking water samples obtained from 16 drinking water refill from Jagakarsa subdsitrict. The method used is descriptive. Refill drinking water samples was taken and tested in the MPN (Most Probable Number) method and then to be tested in identification of E. coli. The results of testing the drinking water refill obtained 15 samples positive for coliform bacteria. Samples were positive for E. coli bacteria that sample B.1 and F.2

    SELEKSI SENYAWA PENGHIDROLISIS UNTUK MENGHASILKAN GULA REDUKSI DARI LIMBAH KULIT ARI KEDELAI SEBAGAI BAHAN FERMENTASI BIOETANOL

    Get PDF
    This study aims to determine the most effective compound used to hydrolyze soy husk waste to produce reducing sugar as raw material for bioethanol fermentation. The study was conducted at the Laboratory of Bioprocess PPPTMGB "LEMIGAS" in April-September 2015. The method used is experiment using a randomized block design consisting of two factors. The first factor is the type of compounds used in the process of hydrolysis, namely H2SO4, HCl, NaOH, and NH3. The second factor is the concentration of hydrolyze compound 0.2%, 0.4%. 0.6%, 0.8%, and 1% (v/v) and every treatment repeated 4 times. Parameters measured were content of reduced sugar hydrolysis product, and secondary data that content of cellulose and hemicellulose also the density of ethanol. Concentration of reducing sugar from hydrolysis of soybean husk is analyzed by two-way ANOVA test. ANOVA analysis result indicate that the best hydrolysis compounds in hydrolizing soybean husk is HCl with the optimum concentration is 0,4%. And there are interactions between treatment of compound used to hydrolyze as well as concentration on reducing sugar concentration (mg/mL) as product from soybean husk waste hydrolysis. Post-hoc test showed that HCl 0,4% produce the highest concentration of reducing sugar at 31.23 mg/mL

    DETERMINASI PEMBERIAN SUKROSA TERHADAP KADAR SGPT DAN SGOT TIKUS GALUR WISTAR SEBAGAI INDIKATOR FUNGSI HATI: Determination of High Sucrose Intake to SGPT and SGOT Concentration in Wistar Rats As Indicator of Liver Function.

    Get PDF
    The aim of the study was to determine the correlation between sucrose intake at various administration doses to SGPT and SGOT level in Wistar rats. SGPT and SGOT level in blood serum were used as parameter of liver function. Twelve rats were grouped according to administration doses (20%, 40%, 60% of given feed total energy and control group). Sucrose was administered orally once a day for 70 days at given doses by force feeding. SGPT dan SGOT level were measured using SGPT and SGOT Test Kit and read using spectrophotometer. The result indicated that increased administration dose caused a significant increase of SGPT and SGOT level

    POTENSI Acrostichum aureum L. (PTERIDACEAE) SEBAGAI BIOAKUMULATOR LOGAM BERAT MANGAN (Mn) DAN TEMBAGA (Cu): Potential of Acrostichum aureum L. (Pteridaceae) as Heavy Metal Manganese (Mn) and Copper (Cu) Bioaccumulator

    Get PDF
    Acrostichum aureum L. is a fern from family Pteridaceae, commonly called as swamp fern or mangrove fern and usually found in mangrove, swamp or brackish area. It noted that heavy metal concentration was found in Acrostichum aureum, but distinction measure in each organs was unknown. This study was conducted to acquire information about heavy metal concentration in Acrostichum aureum, the differential expression of Mn and Cu concentration in each organs, and examine the potential of Acrostichum aureum as Mn and Cu bioaccumulator. Acrostichum aureum and sediment sample taken from Muara Angke Wildlife Reserve, North Jakarta which contaminated by heavy metal Mn and Cu. As a proponent data, Acrostichum aureum and sediment sample also taken from Gunung Kapur Ciseeng that assumpted as uncontaminated area. The methods used was descriptive with purposive sampling technique. The result showed that Acrostichum aureum was bioaccumulator for Mn with BCF average value 1.06. Organs with the highest Mn and Cu concentration was root. U-Mann Whitney test result showed that Mn and Cu concentration in each lower organs significantly different to the upper organs

    KEPADATAN POPULASI MAMALIA DARAT KARNIVORA DI CAMP LEAKEY KAWASAN TAMAN NASIONAL TANJUNG PUTING, KALIMANTAN TENGAH: Population Density Of Terrestrial Mammalian Carnivore In Camp Leakey, Tanjung Puting National Park, Central Borneo

    Get PDF
    Borneo has wide land that support high biodiversity. One of them is Tanjung Puting National Park (TPNP), which have biodiversity such as terrestrial mammalian carnivore. Carnivore has a role to maintain its ecosystems. But, there are no data for population density of terrestrial mammalian carnivore. The object of this research is to find out population density of terrestrial mammalian carnivore in Camp Leakey, TPNP, Central Borneo. This research accomplished in September-October 2015 in Camp Leakey. Using line-transect sampling. Data collection was accomplished at 18.00-24.00 Central Indonesian Time (WITA) on eight transects with three times replication by direct surveys and indirect surveys. This research has obtained five species, malayan sun bear (Helarctos malayanus), sunda clouded leopard (Neofelis diardi), leopard cat, and group of civet, like small-toothed palm civet (Arctogalidia trivirgata) and asian palm civet (Paradoxurus hermaphroditus). Population density of each species from the highest to the lowest is 13,5 Individual of leopard cat/km2, 9,84 Individual of malayan sun bears/km2, 4,31 Individual of sunda clouded leopard/km2, and 3,65 Individual of civet/km2. Malayan sun bears, sunda clouded leopards and civets prefer to be in land forest. Leopard cats prefers to be in transition forest

    FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

    Get PDF
    Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG

    PERKECAMBAHAN 4 AKSESI JEWAWUT (Setaria italica (L.) P. Beauv) PADA KONDISI CEKAMAN KEKERINGAN ARTIFISIAL

    Get PDF
    Developing of jewawut cultivation as an alternative source of carbohydrates is one of the efforts to prevent food insecurity. Drought conditions and the availability of drought-tolerant seeds became one of the problems in the development of jewawut cultivation. The purpose of these experiments were to evaluate jewawut response to drought stress simulations at germination phases and to obtain accessions tolerant to drought stress. Drought stress is performed indirectly (PEG 6000 selective media). The research was done in Laboratory of Physiology of Faculty of Mathematic and Science, UNJ from February until July 2017. The experiments were done with a completely randomized design. Parameters of germination were analyzed with Anova test and continued by Duncan Multiple Range Test (DMRT). Lethal doses of PEG reducing 50% of germination (LD50) were 23,25%, with the quadratic equation y = 1,12-2,72x. The results base on germination phase, Buru merah as drought tolerance accessions, Polman merah and Polman kuning as medium tolerance accession, and Buru kuning as susceptible accessions

    EFEK PROBIOTIK DAN SELUBIOSE TERHADAP VOLATILE FATTY ACIDS (VFA) DAN NH3 RUMINAL DOMBA GARUT

    Get PDF
    The composition of feed can improve and optimize the fermentation in sheep rumen. The purpose of this study is to determine the effect of probiotic and cellobiose to rumen fermentation of sheep. Four adult (weight ±13.5 kg) rumen fistulae sheep were used. The fed given were King grass (Pennisetum purpureum), rice bran and soybean meal that are protected by formaldehyde 0.3% as base feed. Fed treatment were probiotics (0,5% and 1%) and cellobiose (1 ppm and 3 ppm). Parameters measured were pH, N-NH3 and VFA concentration of rumen fluid at 0, 2, 6, 12, and 24 hours after feeding with Completely Randomized Design Factorials 4x5 and continued with Duncan test (α=0,05). The ruminal pH range for all treatments between 6.27 - 6.89. The maximum N-NH3 concentration value has been reached at 2 hours after feeding 12.25-18.75 mM. At 0 hours, the total VFA concentration was at an average value of 294.91 mg% and then increased at 2-6 hours reaching its maximum value in the range 661.97-767.70 mg% (p<0.05). The addition of probiotics and cellobiose can optimize rumen fermentation of sheep

    EFEKTIVITAS MEDIA PERTUMBUHAN KHAMIR KOMERSIAL (Saccharomyces cerevisiae) UNTUK FERMENTASI BIOETANOL DARI ECENG GONDOK (Eichhornia crassipes): Effectiveness of Growth Media Commercial Yeast (Saccharomyces cerevisiae) For Bioethanol Fermentation From Water Hyacinth (Eicchornia crassipes)

    Get PDF
    This study aims to find growth medium commercial yeast (S.cerevisiae) and determine the optimum composition of bioethanol fermentation. This research was conducted at the Laboratory of Bioprocess PPPTMGB “LEMIGAS†along May to September 2015. The method used is experiment using a completely randomized design consisting of two treatment. The first treatment is an alternative growth media utilization, namely, tofu liquid waste, coconut water and a mixture of both. The second treatment is the composition of the fermentation with sugar content of 100 ml, 150 ml and 200 ml with the addition of 10 ml starter in each experiment. Data of commercial yeast cell growth (S.cerevisiae) on alternative growth media were analyzed by Anova one way. The results showed that there was an interaction of commercial yeast cell growth (S.cerevisiae) on alternative growth media. Post-hoc test showed the alternative media that consists of a mixture of tofu liquid waste and coconut water produce the highest commercial yeast cell growth at 25,8 x107 with a 7.62 log value (cells/ml). The most optimum of bioethanol produced in the fermentation process is on sugar 100 ml by the addition of 10 ml starter acquire as much as 45 ml of ethanol content

    SELEKSI TOLERANSI PADI RAWA TERHADAP PH RENDAH DAN PIRIT TINGGI PADA TAHAP VEGETATIF AWAL

    Get PDF
    ABSTRAK Salah satu upaya meningkatkan produktivitas padi ialah dengan memanfaatkan lahan suboptimal yang mempunyai kadar pH rendah dan pirit tinggi. Perakitan padi rawa diharapkan mampu untuk beradaptasi pada kondisi pH rendah dan pirit tinggi tersebut sehingga dapat meningkatkan produktivitas padi di Indonesia. Penelitian ini bertujuan untuk menguji respon toleransi enam galur padi rawa terhadap pH rendah (pH 3 – 4) dan pirit tinggi (300 – 400 ppm) pada tahap vegetatif awal. Penelitian ini dilakukan di Laboratorium Fisiologi FMIPA UNJ pada bulan Januari sampai Juni 2015. Metode yang digunakan dalam penelitian ini adalah eksperimen dengan menggunakan desain rancangan acak lengkap pola faktorial yang terdiri dari tiga faktor. Faktor pertama adalah pH yang tingkat keasamannya rendah (pH 3 – 4) dan tinggi (pH 5 – 6). Faktor kedua adalah pirit dengan konsentrasi rendah (100 – 200 ppm) dan tinggi (300– 400 ppm). Faktor ketiga adalah galur padi rawa yang terdiri dari Inpara 4, Inpara 5, Inpara 6, Inpara 7, Sei Lalan, dan Banyuasin. Parameter yang diukur dalam penelitian ini panjang daun, lebar daun, panjang batang, panjang akar, berat kering daun, berat kering akar, dan klorofil total. Semua parameter diamati dianalisis secara deskriptif dengan menghitung rata-rata dan standar error (±SE). Berdasarkan hasil penelitan didapatkan hasil galur yang toleran terhadap pH rendah dan pirit tinggi adalah Sei Lalan.  Kata Kunci : galur padi, pH, pirit, vegetatif awa

    133

    full texts

    144

    metadata records
    Updated in last 30 days.
    Bioma
    Access Repository Dashboard
    Do you manage Open Research Online? Become a CORE Member to access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard! 👇