Pharmaciana
Not a member yet
    486 research outputs found

    Total flavonoid contents and in silico study of flavonoid compounds from Meniran (Phyllanthus niruri L.) towards alpha-amylase and alpha-glucosidase enzyme

    Get PDF
    Meniran (Phyllanthus niruri L.) is a plant that is reported to contain flavonoids and shows the activity as a type 2 anti-diabetic by a mechanism of inhibiting the absorption of glucose. Flavonoid compounds such as rutin, quercetin and hesperidin shows anti-diabetic activity. This research aims to determine the levels of total flavonoids and docking studies of flavonoids from meniran against α-amylase and α-glucosidase. Analysis of content of total flavonoids utilizes colorimetric method using AlCl3 and routine standard, the docking study uses Autodock Vina (version 1.1.2) program with the assistance of AutoDockTools (ADT) and visualization of docking results using Discovery Study. The results of the determination of total flavonoids level was 12.32 ± 0.53 mgRE/g extract whereas in ethyl acetate fraction and water each were 19.33±0,68 and 20.07±1.23 mgRE/g respectively. Results of all flavonoids dicking study shows the potential to bind to both receptors, rutin has better binding energy towards α-amylase whereas against α-glucosidase is demonstrated by 3-O -β-D-glucopyranosyl-(2-1)-O-β-D-xylopyranoside quercetin

    Construction of recombinant sox2-encoding plasmids that regulate pluripotency of breast cancer stem cells from indonesian patient

    Get PDF
    A therapy development with recombinant protein is a new and potential innovation to destroy cancer stem cells (CSCs). Various ways of killing CSCs include the provision of polyvalent anti-protein antibodies that code pluripotency. Therefore, it takes a mixture of Oct-4, c-Myc, Sox2, and Klf4 protein antigens that can stimulate the formation of polyvalent antibodies. This study aimed to construct Sox2 recombinant by identifying the target genes by reverse transcriptase PCR and then arranging their designs to be inserted into the cloning vector pET101/D-TOPO®. The target gene was developed by finding the complete sequences of Sox2 nucleotides on the NCBI GenBank. The growth on LB-ampicillin agar plates was amplified by PCR to obtain colonies with pET101/D-TOPO® vectors and inserts of the pluripotent gene of CSCs, then the PCR results were observed through electrophoresis. A total of fifteen colonies have DNA bands with a base pair of about 300 bp in length. The recombinant clones produced Sox2 genes with a base length of 330 bp

    Anti-inflammatory activity of essential oil of clove (Syzygium aromaticum) in O/W and W/O Creams

    Get PDF
    Previous studies have shown that the formulations of clove bud essential oil (CBEO) with a concentration of 5% in O/W cream and 2.5% in W/O cream have anti-inflammatory properties. The formulations are developed by adding enhancers, namely oleic acid and propylene glycol. The optimum compositions of oleic acid and propylene glycol are 50%:50% in W/O cream and 30%:70% in O/W cream. This study aimed to determine the effects of different compositions of creams on their anti-inflammatory activities. The creams were evaluated for their anti-inflammatory properties using mice with croton oil-induced inflammatory. The mice were sacrificed, and the back skin was removed to make histopathologic preparations at the end of the three-day inflammatory induction to obtain data of epidermal thickness and the number of cells with COX-2 expression. The results showed that the addition of oleic acid and propylene glycol as enhancers increased the anti-inflammatory activity of both O/W and W/O creams. Since the O/W cream decreased the thickness of the epidermis and the number of cells with COX-2 expression more than the W/O cream, the formulation of CBEO in O/W cream is concluded as a better anti-inflammatory than that of W/O cream.  Â

    Formulation of orodispersible atenolol-β-cyclodextrin tablets with co-processed crospovidone-croscarmellose sodium and poloxamer 188

    Get PDF
    The use of conventional tablets in geriatric patients is currently limited because of a decrease in their physiological functions, such as tremor and difficulty of swallowing pills, which lowers their compliance with drug therapy. Hypertension, one of the degenerative diseases suffered by geriatric patients, is treatable with atenolol tablets or capsules that are less soluble in water or, in other words, has a poor dissolution. This research attempted to improve the dissolution of atenolol by formulating it into orodispersible tablets (ODTs), and as such, the disintegration time was modified by adding co-processed crospovidone-croscarmellose sodium in 1:1 ratio. Moreover, Poloxamer® 188 was added to the formulation of atenolol-β-cyclodextrin inclusion complex. The post-compression test revealed that ODTs disintegrated quickly within 36.67±1.21 seconds (<60 seconds) and had physical characteristics that met the pharmaceutical requirements. The amount of atenolol dissolved within 30 minutes in the dissolution study was 84.39% (%Q30 minutes). The results of the accelerated stability study (at 40 °C and RH 75±5 %) for two weeks proved that the physical and chemical characteristics of the produced orodispersible atenolol tablets were stable

    An interventional study on the effectiveness of peer assistance for medication adherence among hypertensive patients in Purwokerto

    Get PDF
    Hypertension is a disorder of the blood vessels that hampers the transport of supply of oxygen and nutrients to the body’s tissues. Antihypertensive therapy lasts a lifetime and, so, the success of hypertension treatment strongly depends on the willingness of patients to take antihypertensives regularly. Since medical non-compliance can adversely affect the patient's health, medication supervision or peer assistance has been proposed as a way to monitor and remind hypertensive patients to adhere to prescribed daily dosage. This study aimed to determine the effect of peer assistance on adherence to hypertensive medication. It employed a quasi-experimental model with a one-group pretest-posttest design and a peer-based mentoring to achieve drug compliance as the intervention. The research samples were patients registered in the Chronic Disease Management Program (Program Pengelolaan Penyakit Kronis) at two primary health services in Purwokerto. In the first four weeks, a total of 29 respondents acted as the control group without receiving any intervention, and in the second four weeks, they became the intervention group who received peer assistance for their regular drug intake. To measure compliance, the Hill-Bone questionnaire was used. The expected maximum compliance score is 56. The results showed that the average score of compliance increased from 47.69 in the pre-control period to 49 in post-control/pre-intervention and then to 49.93 in post-intervention. The compliances during the control and intervention period had similarly significant differences with p values of 0.008 and 0.039, respectively. In conclusion, peer assistance does not affect patients’ adherence to hypertension treatment

    Antibacterial Activity of Leucaena leucocephala Leaf Extract Ointment against Staphylococcus aureus and Staphylococcus epidermidis

    Get PDF
    Practical experience shows that Leucaena leucocephala has long been used as a medicinal plant. The finely ground, crushed, or chewed leaves of this shrub are applied to the wound. This study aimed to determine the antibacterial activity of L. leucocephala leaf extract ointment against Staphylococcus aureus and Staphylococcus epidermidis. The extract was made by macerating L. leucocephala leaf powder in ethanol 70% with 10% concentration. The research samples included seven (7) formulas of ointments with various L. leucocephala leaf extract (LLE) concentrations, namely F1 (0%), F2 (5%), F3 (10%), F4 (15%), F5 (20%), F6 (25%), and F7(100%). Their antibacterial activities were measured from the diameter of the inhibition zone, which was formed because the administered antibiotics stopped the growth of S. aureus and S. epidermidis placed in Nutrient Agar medium. Gentamicin Sulfate ointment and Oxytetracycline HCl ointment were used as positive controls. The results showed that LLE inhibited the growth of S. aureus and S. epidermidis when prepared at concentrations of at least 20% (F5) and 25% (F6), respectively. The difference between the antibacterial activities of LLE 100% and Gentamicin Sulfate ointment was not significant. The capacities of LLE to prevent the growth of S. aureus and S. epidermidis were lower than Oxytetracycline ointment. These capacities express the antibacterial activity of LLE ointment against S. aureus and S. epidermidis, meaning that LLE can be used as a topical antibacterial agent.Â

    Thermostability and free radical scavenging activity of Annona muricata(L.) leaf extract in antiaging cream

    Get PDF
    Annona muricata is an Indonesian medicinal plant commonly used as an anticancer agent. The finding of its strong antioxidant activity leads to the development of cosmetic products, particularly as antiaging cream. Formulation may influence thermostability and free radical scavenging activity of A.muricata leaf extract. The purpose of this study was to investigate the thermostability and free radical scavenging activity of A.muricata leaf extract incorporated in Gattefosse Skin Cashmere cream. Accelerated stability study utilizing climatic chamber at a temperature of 40ºC ± 2ºC and relative humidity of 75% ± 5% for 20 days of storage was used to evaluate thermostability. 1,1-diphenyl-2-picrylhydrazil (DPPH) using spectrophotometer was used for free radical scavenging activity test. The result from physical properties including appearance of antiaging cream, pH, viscosity and rheological properties of each formula showed that all of the formulas were stable at a temperature of 40ºC ± 2ºC and relative humidity of 75% ± 5% for 20 days. Free radical scavenging activity using DPPH showed high antioxidant activities from the A.muricata leaf extract in the Gattefosse Skin Cashmere cream. We concluded that A. muricata leaf extract could be developed into natural antiaging cosmetic product

    Brief counseling by pharmacists enhances the knowledge, perceptions, and compliance of first and second-trimester pregnant women consuming ferrous fumarate at Jetis Community Health Center of Yogyakarta

    Get PDF
    In Indonesia, the prevalence of anemia during pregnancy increased from 37.1% in 2013 to 48.9% in 2018. It plays a significant part in elevated maternal mortality and perinatal rates. This research aimed to determine the influence of a brief counseling intervention by pharmacists based on the ‘5A’ strategy that had been modified to include the knowledge, perceptions, and compliance of pregnant women with the recommended consumption of ferrous fumarate as anemia treatment and prevention. It is a quasi-experimental study with a pretest-posttest control group design. The data were collected prospectively from December 2018 to February 2019. The sample consisted of 26 respondents, divided into a control group and an intervention group. Each group comprised 13 pregnant women in their first and second trimester (ranging from 12 to 27 weeks). The knowledge, perceptions, and compliance in each group were measured on the first day of visit (Day 1; pretest) and Day 31 (posttest) after the intervention. The results showed a significant difference in average scores between the pretest and posttest in the intervention group (p<0.001 for knowledge, perceptions, and compliance parameters) but an insignificant difference in the control group (p=0.185, p=0.366, and p=0.111, respectively). Score difference or improvement was determined from the relative risk (RR) values of the three parameters (4.55, 4.54, and 10.29, respectively, with p<0.50). As a conclusion, a brief counseling intervention based on the modified ‘5A’ strategy can enhance the knowledge, perceptions, and compliance of first and second-trimester pregnant women at Jetis Community Health Center with the proper consumption of Fe fumarate as an iron supplement

    Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B

    Get PDF
    The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The  repeatability  analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency  value of  206 %. These figures confirm that the method employed  in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA

    Screening of Antiradical Activity From Some Central Sulawesi Mangroves

    Get PDF
    Antiradicals are substances with important functions for human health. Mangrove leaves are one of potential sources of natural antiradical. The objective of this research was to identify the type and fraction of mangrove leaves extract with the highest antiradical activity. The research procedure included sampling and extraction of mangrove leaves, assay of antiradical activity (DPPH), phytochemical assay and determination of IC50 for the fraction with the highest inhibition percentage. Mangrove leave samples (Rhizophora sp., Avicennia sp. and Sonneratia sp.) used in this study were collected from the Palu Bay coastal. Results showed the highest yield of extracts was from Rhizophora sp., followed by Avicennia sp. and Sonneratia sp. Inhibition percentage was higher from dried compared to fresh mangrove leaves. Additionally, the inhibition percentages of the ethanol fraction was higher than that of the ethyl acetate and n-hexane fractions, while Sonneratia sp. gave a higher inhibition percentage than Avicennia sp. and Rhizophora sp. The ethanol fraction IC50 was determined for Sonneratia sp. (46.05 ± 0.18 µg/mL), Avicennia sp. (88.41 ± 0.29 µg/mL) and Rhizophora sp. (103.95 ± 0.38 µg/mL). Phytochemical assays showed that the three ethanol fractions contained flavonoids, phenols (tannins) and steroids compounds. From the research, it can be concluded that the three leaves of mangrove potential as antiradicals

    433

    full texts

    486

    metadata records
    Updated in last 30 days.
    Pharmaciana
    Access Repository Dashboard
    Do you manage Open Research Online? Become a CORE Member to access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard! 👇