Pharmaciana
Not a member yet
486 research outputs found
Sort by
Simultaneous detection of pork and wild boar meat in chicken sausages using the combination of a single primer and real-time polymerase chain reaction (qPCR)
The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica. The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1oC. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat
The cytotoxic activities of the ethyl acetate and butanol crude extracts of marine cyanobacteria collected from Udar Island, Malaysia
The ocean is abundant in organisms beneficial to living beings, including cyanobacteria that are widely studied for their bioactive compounds. This research was conducted to observe the compounds and concomitant cytotoxic activities of cyanobacteria in Udar Island waters, Sabah, Malaysia, against cancer cells. The samples were identified by the 16S DNA method, and a phylogenetic tree was built to check similarities in the genus. The samples were extracted using ethyl acetate and butanol. Afterward, the compounds were determined by Liquid Chromatography-Mass Spectrometry (LCMS), while the cytotoxicity activities were examined by the MTT assay. Several known compounds in ethyl acetate crude extract, such as several types of Apratoxins, and possible new compounds were observed. The compounds examined were mainly peptide. The crude ethyl acetate extracts of Moorea sp. in Udar Island waters were found to contain cytotoxic compounds, with the IC50 value of 0.072 µg/mL against the MCF-7 breast cancer cell lines, that were more potent compared to the butanol crude extract, whose IC50 was 2.031 µg/mL. Further isolation and cytotoxic tests are necessary to confirm which compounds are responsible as cytotoxic agents. This finding provides an opportunity for the discovery of anticancer compounds from marine cyanobacteria
The effect of particle size on dissolution rate of fast dissolving oral film containing diclofenac sodium
Diclofenac sodium is a Non-Steroidal Anti Inflammatory Drugs that if being taken orally have the side effects of peptic ulcers and undergone the first pass metabolism, and also included in the Biopharmaceutics Classification System class 2 which resulted in the low rate of dissolution. This study aims to determine the influence of particle size reduction on the dissolution rate of diclofenac sodium in the form of an FDOF dosage. The formation of diclofenac sodium nanoparticles is carried out by ionic gelation method using chitosan and sodium tripolyphosphate as a crosslinker in various ratios characterized by Particle Size Analyzer and Scanning Electron Microscopy, then it is incorporated into the form of an FDOF that were prepared by solvent casting method at a dose of 12.5 mg using variations concentration of SSG as superdisintegrant and PEG 400 as plasticizer. From the research results, diclofenac sodium nanoparticles are formed in the ratio of chitosan-sodium tripolyphosphate 6:1, have a size of 804 nm and spherical-shaped. The best FDOF dosage formula is F8 containing HPMC E5 LV 35% as the film forming agent, SSG 8% as superdisintegrant and PEG 400 10% as plasticizer. FDOF formula containing diclofenac sodium nanoparticles has a slightly bitter taste, disintegration time less than one minute, surface pH around 7 (neutral), drug content that meets the requirements of the range of determination which is 93.24 ± 0.96, the cumulative amount of drug dissolved in the 28th minute is higher by 88.45% compared to FDOF containing diclofenac sodium raw material, which is only 70.0%
Physical evaluation of lipstick contains encapsulated beet (Beta vulgaris linn.) root water extract in maltodextrin
The natural dyes from beet (Beta vulgaris Linn) (BV) roots can be used as coloring agents in lipsticks. However, the dye has low stability in high temperature and light and can be oxidized by air. The dye was encapsulated into a microparticle (MP) using maltodextrin (MD) as a matrix to improve color stability. The research's objective was to evaluate the effect of various MD concentrations in encapsulated BV root extract towards physical characterizations of MP and lipsticks, including pH, lipstick hardness, melting point, and color stability. The BV roots water extract was obtained by grinding BV root into a juice and then dried using a freeze dryer. The encapsulation of the BV root extract was using MD as a matrix with a ratio of 1:5 BV dried extract to MD. The MD solution concentrations used in this experiment were 25%, 50%, and 75% (w/v). The result showed that the morphology of MPs resulting from the encapsulation is amorphous. Lipsticks were characterized by pink color and had shape according to the lipstick mold. The lipstick color changed to brown on the seventh day and faded on the 28th day. The variation of MD concentrations during MP preparation did not significantly influence the lipstick's pH value, hardness and melting point
Antioxidant and antiaging activity of rutin and caffeic acid
Aging is a complicated process occurring due to the combination of incremental alterations of the skin and accumulated extrinsic factors that causes both structural and functional disruptions. The extrinsic factor of skin aging is mostly caused by free radicals, UV exposures, and pollution. Prevention is possible by escalating antioxidant intake to scavenge ROS in the skin aging process. Rutin and caffeic acid are recognized for their free radical trapping effects and reported to have potential antiaging activities. This study aimed to identify the potentials of rutin and caffeic acid as antioxidant and antiaging. Rutin and caffeic acid were tested for their antioxidant properties using the DPPH, H2O2, ABTS radical scavenging, and FRAP assays. Meanwhile, their antiaging activities were examined by collagenase, elastase, hyaluronidase, and tyrosinase inhibitory assays. The study drew on the evidence of antioxidant and antiaging properties from the scavenging, ferric ion reducing, and inhibitory activities of rutin and caffeic acid (in ascending order): in scavenging DPPH free radicals (IC50 of rutin = 5.79 µg/mL, IC50 of caffeic acid = 8.72 µg/mL), scavenging H2O2 ( IC50 rutin = 12.09 µg/ml, IC50 caffeic acid = 15.23 µg/mL), reducing ABTS (IC50 caffeic acid = 6.23 µg/mL, IC50 rutin = 16.59 µg/mL), reducing ferric ions at 50 µg/mL (FRAP of rutin = 480.08 µM Fe(II)/µg, FRAP of caffeic acid= 526.50 µM Fe(II)/µg), inhibiting collagenase (IC50 caffeic acid = 74.42 µg/mL, IC50 rutin = 104.70 µg/mL), inhibiting elastase (IC50 rutin = 46.88 µg/mL, IC50 caffeic acid = 76.95 µg/mL), inhibiting tyrosinase (IC50 rutin = 55.65 µg/mL, IC50 caffeic acid = 145.91 µg/mL), and inhibiting hyaluronidase (IC50 rutin = 114.07 µg/mL, IC50 caffeic acid= 244.45 µg/mL). Rutin and caffeic acid have the potentials as antiaging and antioxidant
Decreased total cholesterol levels in rats administered with chitosan from Green mussel (Perna viridis L.) shells
Chitosan has been known to have anti-cholesterol activity. This linear polysaccharide can be derived from the chitin of green mussel shells by deacetylation. The purpose of this research was to find out the effects of administering chitosan from green mussel (Perna viridis L.) shells on total cholesterol levels. Chitosan was prepared in three steps, namely deproteinization, demineralization, and deacetylation. FTIR was used for characterization, and the absorbance values were calculated to obtain the degree of deacetylation. A total of 24 male Wistar rats were fed with high-fat ingredients (yolk, quail, used cooking oil) and 1% PTU for 30 days p.o and divided into six (6) groups, namely the normal control group, negative control (PGA 1%), positive control (Simvastatin at 0.9 mg/Kg BW), Dose 1 (chitosan at 250 mg/Kg b.w), Dose 2 (chitosan at 500 mg/Kg BW), and Dose 3 (chitosan at 750mg/Kg BW). The chitosan of green mussel shells had a deacetylation degree of 43.05%. The results showed that the three doses of chitosan exhibited reduced total cholesterol levels in the test rats. At a dose of 750 mg/Kg BW, chitosan led to the most significant reduction of total cholesterol levels in rats from averagely 127.1 to 74.2 mg/dL
The antioxidant activity and stability of yogurt fortified with rosella (Hibiscus sabdariffa Linn) calyx extract
Roselle calyx  (Hibiscus sabdariffa Linn) contains many anthocyanins. The purpose of this study was to determine the anthocyanin stability and antioxidant activity of rosella calyx extract and rosella calyx fortified in yogurt. Roselle calyx extract (Hibiscus sabdariffa Linn) was obtained by the infundation method using water at 90 ° C for 15 minutes. Rosella calyx extract was made into yogurt with a concentration of 0%, 2%, 4% and 8%, full cream liquid milk 13% (100 ml), and a 5% bacterial starter combination concentration (1: 1 b/v). The yogurt evaluation included a stability test with storage at 4°C and antioxidant activity using the DPPH method on 0, 7, 14, 21, and 28 days. The data was statistically analyzed using Multivariate Analysis of Variance (MANOVA). The anthocyanin stability of the three samples, namely roselle extracts of 2%, 4%, and 8%, significantly different (p <0.05) for each concentration of roselle calyx extract and the antioxidant activity of roselle calyx yogurt in the three samples 2% 4% and 8% were significantly different for each concentration of rosella calyx extract added to yogurt. During storage, anthocyanin stability and antioxidant activity of rosella calyx yogurt extract on day 0 to 7 did not differ significantly, while 14 to 28 were significantly different. The 4% and 8% concentrations of rosella calyx yogurt produce optimal yogurt formul
The gastroprotective effects of arrowroot tuber starch (Maranta arundinacea L.) on ethanol-induced gastric damages in rats
Empirically, arrowroot tubers (Maranta arundinacea L.) have been widely used in the treatment of gastric ulcers. They are known to contain carbohydrates and flavonoids that play a role in reducing inflammation. This study sought to identify the gastroprotective effects of arrowroot tuber starch (Maranta arundinacea L.) on the ulcer index, % protection ratio, and the histopathological image of Wistar rat models of gastric ulcers. The test animals were divided into six groups. Group I was given free access to food and water (normal control), while Group II was given ethanol without treatment (negative control). Groups III, IV, and V were treated with arrowroot tuber starch at the doses of 125, 250, and 500 mg/kg BW, respectively. Group VI was given sucralfate at the dose of 400 mg/kg BW (positive control). All treatments were administered orally for 14 days and followed by 24 hours of fasting. On Day 15, all groups, except for the normal control, were given 96% ethanol orally at the dose of 1 ml/200gr BW. After one hour, they were dissected, and their stomach was removed for further analyses. The results showed that the administrations of arrowroot tuber starch at 125, 250, and 500 mg/kg BW produced ulcer indices of 2, 1.25, and 1.5, respectively, smaller than the negative control (4.25), and % protection ratios higher than the positive control. The histopathological imaging showed that the stomach of rats receiving arrowroot tuber starch at 250 mg/kg BW presented no pathological changes. Based on these findings, the arrowroot tuber starch is proven to have the ability as a gastroprotective agent
The development of antioxidant peel-off facial masks from cinnamon bark extract (Cinnamomum burmannii)
The bark of cinnamon (Cinnamomum burmannii) contains cinnamaldehyde and other active substances with potent antioxidant properties. Antioxidants are effective at preventing and reducing UV-induced skin damages and skin aging. This study was intended to formulate and characterize the antioxidant peel-off facial masks containing cinnamon bark extract and the combination of polyvinyl alcohol (PVA) and hydroxypropyl methylcellulose (HPMC) as gelling agents. The ethanol extract of cinnamon bark and the developed peel-off mask were evaluated for their antioxidant activities by the α,α-diphenyl-β-picrylhydrazyl (DPPH) free radical scavenging method and for their physical characteristics. The cinnamon bark extract exhibited a very strong antioxidant activity, as evidenced by IC50= 10.04 ± 0.08 ppm. As for the formulated peel-off mask, it had excellent physical characteristics, which were identified during organoleptic observations and pH, viscosity, spreadability, and film drying time evaluations. Similar to its constituent extract, this mask produced significantly potent antioxidant effects, with IC50= 47.31 ± 1.47 ppm. For these reasons, peel-off facial masks containing cinnamon bark extract have not only excellent physical characteristics but also powerful antioxidant properties
Cox-2 inhibition activities of creams containing anguilla bicolor and sea cucumbers extract on croton oil induced inflammation in mice
The fatty acids, like EPA and DHA, were known as anti-inflammation. It works on inflammatory tissue, brought by edema plasma, and changed into resolvins, protectins, and maresins by the enzyme reaction. Anguilla bicolor and Sea cucumber fish are known to contain EPA and DHA. This study analyzes the inhibition Cox-2 effect of the combination of Anguilla bicolor oil with Sea cucumber extract as an active ingredient in a cream preparation. This experiment used 7 groups of male BALB/C strain mice: normal control; negative control; positive control; A. bicolor oil cream; H. leucospilota extract cream; a combination of A. bicolor : H. leucospilota (2:1) cream; a combination of A. bicolor : H. leucospilota (1:2) cream. The anti-inflammatory activity was evaluated by the amount of inflammatory cell, the thickness epidermis, and the amount of cell expression COX-2 on mice's back skin tissue induced by croton oil (0,1 %). After 3 days, histopathological skin tissues were made. The data were analyzed statistically by One Way ANOVA followed by LSD to know each group's differences at a significance level of 0.05. The experiment results showed that the formula with the best anti-inflammatory activities is the combination of A. bicolor and H. leucospilota (2:1) cream. The decrease of the amount of inflammatory cell (75.97%), the thickness of the epidermis (43.88%), and the amount of COX-2 cell expressions (60.52%) from the formula did not differ significantly with the positive control (p>0,05). It can be concluded that A. bicolor and H. leucospilota have anti-inflammation activity based on the experiment results