Open Journal System Universiti Malaysia Kelantan
Not a member yet
1069 research outputs found
Sort by
PEMBENTUKAN JATI DIRI DI KANAK-KANAK MELALUI TEKS ADIK SAYANG PANTUN
No full textAbstrak
Pantun kanak-kanak merupakan sejenis puisi tradisional Melayu. PKK bukan sekadar memberi hiburan tetapi juga memberi pengajaran dan pendidikan serta mampu membentuk jati diri kanak-kanak menjadi seseorang yang berkeperibadian tinggi. Selain itu, PKK juga dicipta dengan bentuk yang ringkas seiring dengan meningkatkannya usia kanak-kanak yang gemar akan bahasa yang mudah dan berirama. Justeru itu, kajian ini akan menggunakan teks kumpulan pantun kanak-kanak yang berjudul Adik Sayang Pantun oleh Ismail Restu yang diterbitkan Institut Terjemahan dan Buku Malaysia pada tahun 2014 di Kuala Lumpur. Kajian ini dilakukan bertujuan untuk menambah baik hasil kelompongan daripada kajian yang dilakukan oleh pengkaji lepas. Hal ini kerana pengkaji dapati kajian mengenai pemberdayaan jati diri kanakkanak menerusi pantun kanak-kanak masih lagi kurang dilakukan oleh pengkaji lepas. Seterusnya, objektif utama dalam kajian ini adalah mengenal pasti pantun yang membentuk jati diri kanak-kanak dalam teks Adik Sayang Pantun dan menganalisis keindahan pantun kanak-kanak berdasarkan teori Puitika Sastera Melayu. Oleh itu, dalam dapatan kajian akan mengetengahkan beberapa tema seperti tema pantun berbudi bahasa (PBB), pantun ii menghormati (PMH), pantun bersopan santun (PBS), pantun menolong (PMG), pantun penghayatan warisan (PPW) dan pantun kebudayaan kaum (PKK) dalam membentuk jati diri kanakkanak serta mengaplikasikan teori Puitika Sastera Melayu oleh Muhammad Haji Salleh dalam melihat keindahan PKK. Oleh yang dikatakan sedemikian, kajian ini akan membuka mata masyarakat bahawa PKK sangat sesuai diletakkan dalam silibus mata pelajaran bahasa Melayu di sekolah sekali gus dapat dijadikan wadah dalam membentuk jati diri kanak-kanak.
Abstract
Children\u27s poems (PKK) are a type of traditional Malay poetry. PKK does provide not only entertainment but also teaching and education. It also moulds children\u27s identity into someone with a high personality. In addition, PKK was also created in a simple form along with the increasing age of children fond of simple and rhythmic language. Therefore, this study will use the text from a collection of children\u27s poems entitled “Adik Sayang Pantun” by Ismail Restu, published by the Malaysian Translation and Book Institute in 2014, Kuala Lumpur. This study was conducted to improve the gap from previous studies. It is because the researcher found that a study on the formation of self-identity in children is still lacking. Next, the main objective of this research is to identify the poems that shape the sense of identity in children from the text and to analyze the beauty of children\u27s poems based on the theory of “Puitika Sastera Melayu”. Eventually, the findings of the study will highlight several themes such as polite poems (PBB), respectful poems (PMH), polite poems (PBS), helpful poems (PMG), heritage appreciation poems (PPW) and ethnic, cultural poems ( PKK) in shaping children\u27s identity through the lense of “Puitika Sastera Melayu” by Muhammad Haji Salleh as a theoretical foundation in seeing the beauty of PKK. With that being said, this study will open the eyes of the public that PKK is very suitable to be placed in the syllabus of Malay language subjects in schools and eventually can be used as an instrument for the formation of a sense of identity in children
Most Influential Factors Affecting International Trade Flows: Bangladesh Context
No full textA country cannot go well without involving international trade because of the interconnected world economy. Every nation involves international trade for its economic welfare and some factors influence a lot to involve international trade. The influencing factors are factor endowments, trade policies, exchange rate, inflation rate, disposable income, and others. Bangladesh is doing well in international trade in recent years compared to eighty\u27s decade, although the country is experiencing a negative trade balance regularly. The low-cost labour is an important influential factor that the country is using efficiently. National and intentional trade policies are influencing a lot of the international trade, for example, Venezuela, North Korea, Iran, and some other countries cannot involve in international trade expectedly due to the sanction of the USA. The economic diplomacy of Bangladesh is helping a lot but it could have improved. The inflation rate of Bangladesh was stable after 2012 which helps to maintain the international trade balance. Besides, the Exchange rate and foreign currency reserve are the motivational factors of international trade because domestic currency value is an important determinant of international trade. Bangladeshi BDT maintains an almost stable exchange rate with USD but after COVID-19 the rate fluctuated at a lower rate. To involve in international trade, there is no opportunity to avoid the influence of these factors or elements.
Keywords: International Trade, factor endowments, trade policies, exchange rate, inflation rate, disposable income
Inventory Management Practices and Organizational Productivity in Nigerian Manufacturing Firms
No full textThis study examined the relationship between inventory management practices and productivity of selected manufacturing firms in Nigeria. The inventory management practices examined include inventory record accuracy, lean inventory system, buffer stock management and Information and Communication Technology. In addition, organizational productivity was measured along two dimensions namely: organizational effectiveness and organizational efficiency. A survey research design was adopted for the study. The population of the study comprises employees in the following departments – commercial, finance, production, distribution and inventory – of five selected manufacturing companies in Benin City. A sample size of two hundred and sixteen (216) employees from Seven-Up Bottling Company Ltd, Global Horn Industry PVC Ceiling Limited, Integrated Rubber product Nigeria Plc., Livestock Feeds Plc and Nigeria German Chemicals in Nigeria were selected for the study. The instrument for data collection was a questionnaire. Data collected from the questionnaire were analysed using frequency distribution, mean, correlation and regression. All analyses were done using the Statistical Package for the Social Sciences (SPSS) software. The findings of the study revealed that inventory record accuracy, lean inventory system and information technology have a positive and significant effect on organizational productivity in Nigeria while buffer stock management was found to be insignificant. The study recommends the need for manufacturing firms to improve their inventory record accuracy by using system-based inventory management practices to enhance organisational performance
Comparative Study of Intercity Transport Companies In Benin City, Nigeria
No full textThis study examined comparative study of intercity transport companies in Benin City, Nigeria. The study sample consists of four hundred respondents drawn from across the four leading interstate transport companies in Benin City. A questionnaire instrument was used to gather the needed information and the analytical techniques employed include simple percentage, t-test and Analysis of variance (ANOVA). All tests were performed at the 0.05 level of statistical significance. The findings revealed that God is Good Motors was rated far higher than the other transport companies by passengers while Iyare Motors was rated the least. Furthermore, we found that there is no significant relationship between respondents’ gender and customer perception of service quality in interstate transport companies. However, educational qualification and age had a significant relationship with passengers’ perception of service quality. We recommend that interstate transport companies should concentrate more on issues such as safety, comfort on the road, respect for passengers and regular maintenance of vehicles as well as replacing unserviceable vehicles with new ones to avoid frequent vehicle breakdown on the high wa
COVID 19 Outbreak and Tokyo 2020 Olympic Games: A Perspective from Japan’s Economy and Capital Market
No full textThis study highlights the key impacts of hosting an international sports event, Tokyo 2020 Olympic Games, during the period of deadliest contagious disease outbreak in history, COVID 19. The perspective is analysed in terms of the performance of capital market, investment market and sectoral market by the indexes of TOPIX, Stock Market, Bond Market, Foreign Exchange, FTSE, MSCI, and sectoral index of Air Transportation, Construction, Pharmaceutical which shows different range of fluctuation
Biostratigraphy and paleodepositional environment of the Temburong Formation at Batu Luang, Klias Peninsula, Sabah based on calcareous nannofossil.
No full textGenerally, the Temburong formation was observed for both research studies and hydrocarbon exploration. There was few research conducted on its lithostratigraphy and micropaleontological purposes in terms of research studies. However, there is no evidence suggested to observe the paleoenvironment condition of the formation based on the calcareous nannofossils occurrences. Therefore, this research was performed deliberately to identify paleoclimate prediction of Batu Luang, Klias Peninsular based on the assemblages of the calcareous nannofossils. 17 samples have been collected from a measuring section of a cutting hill along the road. Simple smear preparation was used and observed their assemblages were under the light microscope. As many as 27 species have been identified and dominantly preserved by discoasters and sphenolithus. Thus, this formation has been considered an oligotrophic condition and low latitude region due to the distribution of warm-water taxas. Plus, less contribution of cold-water taxa Coccolitus pelagicus to the formation is late Oligocene to early Miocene
A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia
No full textA study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCA GAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to, R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia
Molecular detection of chicken astrovirus in broiler chicken, Malaysia
No full textThe emergence of avian diseases can cause major economic problems due to production losses and mortality in domestic poultry. Astrovirus is frequently associated with enteric diseases in poultry, being isolated from cases of runting-stunting syndrome (RSS) of broiler chickens, poult enteritis complex (PEC), and poult enteritis mortality syndrome (PEMS) of turkeys. Avian astrovirus can be detected in chickens from both healthy and poorly performing flocks. In Malaysia, information and reports regarding chicken astrovirus (CAstV) in poultry are limited. The objective of this study is to perform a phylogenetic study on the avian astrovirus isolated from a suspected case in 2019 and to determine the subgroups of avian astrovirus strains that existed in Malaysia. Reverse Transcription Polymerase chain reaction (RT-PCR) was performed based on the partial ORF1b gene and the nucleotide sequence was analyzed. Phylogenetic analysis showed that this isolate was clustered together with CAstV strains from several strain from USA, Malaysia and others. Furthermore, the isolate from broiler chicken showed 97.2% to 99.4% of its nucleotide identity with isolates from the American strains, compared to the previously CAstv Malaysia strain, which shared 94.8% to 95%.Therefore, the current study provides important information on the epidemiology of CAstV and highlights the importance of control strategies against CAstV-infected poultry in Malaysia
Strategies in Translation of Geographical Names in the Novel Journey to the West
No full textTranslating proper names could be challenging as they contain aspects of historical, semantic, geographical, or social meanings of a particular culture. Such problems are extended to the translation of geographical names in which a mistranslation may confuse the readers and jeopardize (the entire) translation as a result of “unsuccessful rendition” of a place name. This study explored the types of geographical names in the classic novel Journey to the West, described how these names were translated into English, and sought to what extent the meanings of the names were retained in the TL. This qualitative study adapted Urazmetova and Shamsutdinova (2017), and Fernandes’ (2006) frameworks in identifying the types of geographical names and translation procedures. The findings showed that geographical names could be divided into natural and man-made, while the major procedures in the translation of geographical names were rendition, transposition, and mixed procedure. Although, some minor loss of meaning in translations was identified, the frameworks were found effective (i.e., successful rendition) in retaining most of the original meanings, as well as the analysis of geographical names and the translation of proper names. Translation researchers could further investigate translation solutions for translating names by exploring the interrelations between language, culture, and translation through tackling the translation problems
Language Policy from Functions to National Ethos: Consensus of Malay Linguist Experts
No full textMalaysia\u27s language policy has declared Malay as the national and official language. However, in facing the uncertain future, measures are taken where some of the language ethos; the value codes regulating the social life of multiracial Malaysians should be implemented accurately. This study discusses six ethos of Malay language which are: (i) Malay as the national language, (ii) Malay to shape national identity, (iii) Malay to foster patriotism, (iv) Malay to nurture nationalism, (v) Malay as the symbol of national dignity, and (vi) Malay as the national image. A combination of quantitative and qualitative methods was implemented in this study using the Delphi technique. 10 experts in the field of Malay linguistics were selected as informants. In the first round, the study was conducted through interviews to gather views regarding the ethos of Malay language. Next, the consensus among experts is obtained through Median Calculation and Inter-Quarter Range (JAK). The results found are 30 elements which consists of 5 main elements for each of the six themes presented. The featured themes are Malay as the national language, as a symbol of national identity, to foster patriotism, to nurture nationalism, to represent national dignity and as a symbol of the national image. Overall, six themes and 30 elements were proposed and agreed upon by ten experts from Malay linguistics. This is important as a framework of reference to ensure the continuity of the national ideas and strengthen the present national language policy.