Open Journal System Universiti Malaysia Kelantan
Not a member yet
1069 research outputs found
Sort by
Transformational Leadership of Head Teachers and Levels of Conflict Management of National School Teachers in City Districts
The school is under a coherent and uniform education system but is composed of different leadership lines assisted by teachers who learn teaching using the same system and syllabus according to their respective options. What teachers will go through is working under diverse leadership styles and climates. The transformational leadership style is oriented to the existence of a climate conducive to subordinates. This study aims to identify the level of transformational leadership practice of headmasters, the level of conflict, differences significance of teachers according to gender, age and experience and the relationship between transformational leadership of headmaster and conflict among teachers of Sekolah Kebangsaan di Daerah Kota Setar. The study involved 30 respondents consisting of teachers Sekolah Kebangsaan di Daerah Kota Setar. The study variables were tested using descriptive statistics and inferences involving mean scores, standard deviations, independent sample t-tests, one-way ANOVAs dan Pearson correlation. Data were analyzed using IBM SPSS version 26.0 for windows. The findings show that the transformational leadership of the headmasters (Min = 4.20; SD = .58 ) and the teacher conflict management (Min = 3.60; SD = .46 ) are high. Pearson\u27s correlation analysis found that ten dimensions of headmasters’ transformational leadership had NO significant relationship with teacher conflict management. Finally, the findings of this study are expected to contribute significantly to the body of knowledge by highlighting the relationships among the variables involved. The findings of this study can also be used by certain parties to realize school excellence
I Medikel: A Pharmaceutical Gem Beyond The Golden Triangle
This case provides an analysis of the current issue faced by I Medikel Group. I. Medikel started its first business more than 25 years ago. The findings show that the company has a positive reputation. In 2001, the company expanded its operation by building a plant to produce spirulina-based health supplements. I Medikel is the family business that Haji Mohd Idris started with his siblings, both of whom graduated in the field of pharmacy. However, there are some major weaknesses that require further investigation and action to be taken by the management. Recommendations made include strategies for time efficiency; optimization of productivity to effectively lower the cost; development of a unique selling point (USP) that caters to the customer’s demand; creating awareness of the difference between original and fake products; and building powerful and unique marketing content. In a nutshell, this report will discuss in detail the issues and challenges faced by I Medikel in order to make sure they can be corrected in the future and also act as a reference for the owner of I Medikel in identifying the issue.
=====
Case Teaching Strategy
This case is rated medium to difficult; depending on how deep the analysis one wants to undertake. The case should be distributed to participants or students a few days before the discussion session takes place, and at least THREE HOURS should be allocated for the discussion and class activity. If desired, the initial discussion can be conducted in groups of THREE or FOUR participants/students and followed by a general class discussion. For students, the case study can be used for a long report in lieu of the traditional final exam.
====
Teaching note You do not currently have access to these teaching notes. Please email at [email protected] if you require the teaching note. Teaching notes accompany case studies with suggested learning objectives, classroom methods, and potential assignment questions. They support dynamic classroom discussion to help develop student\u27s analytical skil
Total phenolic content (TPC) in Catharanthus roseus and Clitoria ternatea leaves extract
Catharanthus roseus or “Kemunting Cina” and Clitoria ternatea or “Bunga Telang" had a long reputation as a traditional remedy in South East Asia. One of the important components that contribute to these plants\u27 remedial capabilities is the secondary metabolic known as phenolic. In this study, the Total Phenolic Contents or TPC in Catharanthus roseus and Clitoria ternatea leaves extract have been obtained and compared. Leaves from both species were dried and the extract was acquired using 90% ethanol via a rotary evaporator. Two major tests were conducted which are the qualitative test and quantitative test. The qualitative test was done to ensure the existence of phenolic in the samples. Meanwhile, the quantitative test is to measure the concentration of phenolic in the samples. Both samples show a positive result in a qualitative test where the extract of the sample changed from green to dark green in the Ferric Chloride test. Next, Folin- Ciocalteu assay acted as the quantitative test to determine the TPC in the samples, and the absorbance was measured at 760 nm. The test was triplicated to ensure the consistency of the results. The total phenolic content for Catharanthus roseus is 36.33600 ± 0.935313mg/GAE and Clitoria ternatea is 7.35767 ± 0.046188mg/GAE. The TPC in Catharanthus roseus is higher than Clitoria ternatea. The t-test shows that there is a significant difference in concentration of total phenolic content between Catharanthus roseus and Clitoria ternatea (
Assessing Growth Performance and Yield of Okra (Abelmoschus esculentus (L.) Moench) Using Slow-Release Fertilizer
The agricultural sector has contributed to environmental pollution, such as water and air pollution caused by the fertiliser used in agriculture is lost into the river or to the air through the leaching process. Studies in the literature have shown that slow-release fertiliser (SRF) application could help overcome the leaching problem as it releases its nutrients slower. In other words, SRF is expected to help maintain the nutrients\u27 availability in the soil for a more extended period and extends the plants\u27 nutrient uptake efficiency. The experimental design for this study was completely randomized design with 4 different treatments T0 (control) was treatment without fertilizer application; T1 (SRF applied once in a month); T2 (CF applied once in a month); T3 (SRF applied twice in a month) and T4 (CF applied twice in a month). This study aimed to compare the plant growth rate (plant height, number of leaves and plant yield) of using SRF and conventional fertiliser (CF) on okra (Abelmoschus esculentus L. Moench). This study shows that SRF does show a good option to promote the growth development of okra (plant height, number of leaves and chlorophyl content) but not on the yield
A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia
A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCAGAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to , R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia
توظيف طريقة الـمحاكاة في التعليم والتعلم لتعزيز مهارة الـمحادثة باللغة العربية لدى الطلاب الناطقين بغير العربية
تعرض هذه المقالة عن توظيف طريقة الـمحاكاة في تعليم اللغة العربية وتعلمها لتعزيز مهارة الـمحادثة باللغة العربية للطلاب الناطقين بغيرها، وتهدف هذه المقالة إلى علاج مشكلة الدارسين الـمعروفة والمتمثلة في عزوفهم عن المحادثة باللغة العربية على الرغم من طول الفترة التي قضوها في تعلم لغة القرآن. وكذلك تقدم المقالة مقترحا بالطريقة المناسبة لتوظيف المحاكاة في تعليم اللغة العربية وتعلمها وصولا إلى معرفة مدى فاعلية طريقة المحاكاة في تعزيز اللغة العربية للناطقين بغيرها. وقد سلكت المقالة المنهج الوصفي في تقديمه للموضوع وذلك بالعودة إلى جمع البيانات النظرية، وكذلك طرح بعض التجارب والخبرات في هذا المجال. ومن الجدير بالذكر أن المقالة تؤكد بأن طريقة المحاكاة لها دور بارز في تعزيز مهارات المحادثة باللغة العربية للناطقين بغيرها أثناء ممارستهم لهذه الطريقة. كما يحث الـمتخصصين في مجال التعليم على توظيف هذه الطريقة في لقاءاتهم التعليمية، ومن الملاحظ أن تطبيق هذه الطريقة ستحسن من مستوى مهارات المحادثة لدى الدارسين، وتجعلهم أكثر حماسة وجرأة لممارسة المحادثة دون خجل، علاوة على ذلك تنمّي ثروتهم اللغوية المعاصرة، وتعودهم على التعلم الذاتي والإبداع في المحادثة. وتوصي المقالة بأن تُسَخَّر وسائل المعلومات والاتصالات الحديثة في خدمة التعليم والتعلم في مؤسساتنا التربوية، كما ينبغي الاهتمام بتدريس مهارات الـمحادثة للطلاب الناطقين بغير العربية من خلال استخدام استراتيجية المحاكاة التي تيسر للدارسين اكتساب الـخبرات التعليمية الـمقدّمة لهم، والعمل على تحسين عملية تعليم اللغة العربية وتعلمها للناطقين بغيرها وتطويرها بشكل مستمر
Pemikiran Ibn Khaldun Tentang Rasionalisme Islam: Suatu Penelitian Ringkas
This paper briefly discusses Ibn Khaldun’s philosophical and rational construction of Islam and its compelling argumentative discursive as set forth in his classical works such as kitab al-‘Ibar, Al-Ta‘rif, Tahrir al-Ahkam, and al-Muqaddimah. This works expressed his highly rational outlook that developed critical and rational understanding of religious and moral premises. It also summarized its dynamic ground that contribute to expound instructive discussion of related ideas and themes. The study is based on library research using content analysis and analyzed through analytical and descriptive approaches. The finding concludes that Ibn Khaldun has bring forth rational interpretation of history based on unique philosophical and socio-cultural analysis introduced in his al-Muqaddimah. Tahis characteristic approach of rational ideal has significantly impacted Islam’s modern history and intellectual tradition. His rational and argumentative principle has largely influenced the works of contemporary Muslim thinkers such as Malik Bennabi, Rashid Ghannouchi and Muhammad Asad
Tahap Kefahaman Guru Bahasa Inggeris Terhadap Pedagogi Terbeza
Pelaporan Kurikulum menunjukkan peratus pencapaian Bahasa Inggeris yang rendah dalam peperiksaan akhir tahun 2019 bagi sekolah rendah dalam PPD Kota Bharu. Fokus Analisa pencapaian ditumpukan kepada murid Tahun 6. Pencapaian murid berkait secara langsung dengan kaedah pengajaran guru di dalam bilik darjah. Murid-murid Tahun 6 menunjukkan prestasi yang lemah dalam Bahasa Inggeris terutamanya penulisan. Pencapaian murid-murid adalah pada tahap sederhana (65.00%). Objektif kajian ini bertujuan untuk meningkatkan tahap kemahiran guru dalam PdP melalui aplikasi pedagogi terbeza. Penekanan diberikan kepada aktiviti yang dilaksanakan oleh guru dengan memberi keutamaan kepada aktiviti berpusatkan murid. Dalam konteks ini, masalah pencapaian Bahasa Inggeris yang rendah didapati berpunca daripada kelemahan PdP guru Bahasa Inggeris di bilik darjah. Kaedah yang digunakan didapati kurang berkesan dan tidak menarik minat murid untuk belajar. Proses bimbingan guru secara pemerhatian bersemuka di dalam bilik darjah dan temubual. Pengkaji membuat pemerhatian semasa guru mengajar di dalam kelas. Selepas PdP dilaksanakan, sesi temubual dan perkongsian amalan dibuat. Pemerhatian kedua dilakukan selepas rawatan diberikan. Dapatan menunjukkan bahawa Pedagogi Terbeza telah dapat membantu peningkatan kemahiran dalam kaedah mengajar guru. Guru telah dapat merancang satu sesi pengajaran yang berkesan dan melaksanakan aktiviti PdP dengan aktiviti-aktiviti berfokuskan murid yang menarik. Tahap keyakinan guru juga telah meningkat dan dapat menghasilkan video rakaman bagi sesi pengajaran yang telah dilaksanakan. Tahap pencapaian murid dalam Pentaksiran Bilik Darjah pada akhir 2020 didapati telah menunjukkan peningkatan yang sifnifikan. Hasil daripada kajian ini, pengkaji mencadangkan bahawa Pedagogi Terbeza telah dapat membantu guru dalam meningkatkan tahap kemahiran melaksanakan PdP yang berkesan, menyeronokkan dan menarik minat murid
Wau Animation Studio: The Mastermind Behind ‘Ejen Ali The Movie\u27s\u27 Rm 30 Million Box Office Haul
WAU Animation Studio, a relatively new company, shocked everyone in 2019 when their film "Ejen Ali The Movie" made RM30 million in profit. WAU Animation Studio was established on March 18, 2013 by Usamah Zaid Yasin, who is also the company\u27s Chief Executive Officer. Prior to the release of Ejen Ali The Movie, the animation studio created an animated series with the same title, which aired on Malaysian television channel TV3. A group of creative talents in the animation company has successfully generated quality content to the point of winning numerous awards for the animated series and film category of choice, thanks to their seven-year experience. Their tenacity and perseverance in this industry has paid off, as every production aired on tv has been well received by audiences of all races and ages.
Muhammad Usamah Zaid Yasin is a successful Malaysian animator who was born on December 19, 1983. During his time with the company Les\u27 Copaque, he was one of the most influential figures in the development of the animated series Upin & Ipin. Then, in 2013, he resigned from Les\u27 Copaque and founded WAU Animation Studios. The Multimedia University (MMU) graduate\u27s seven-year experience with Les\u27 Copaque Production has given him the motivation and excitement to form a company with several other key individuals to develop the Malaysian animation industry. The dedication he shows must have held some secrets since the new company was able to produce animated films on par with foreign animated films
The Influence of Investment On The Economy In Riau Province Indonesia
Economic growth is very important for all countries, one way to increase economic growth is to invest in both Domestic Investment (PMDN) and Foreign Investment (PMA). This study aims to analyze the effect of investment on economic growth in the Province. This research is quantitative research using secondary data from the Central Statistics Agency of the Republic of Indonesia, especially in the Province of Riau. The study results show that foreign investment and domestic investment, as well as several superior business sectors in Riau province, basically increase gross domestic product, which means it affects the economic growth of Riau province. The hope is that there is a need for coordination and a clear division of tasks and responsibilities between government units in districts in Riau Province to improve infrastructure services. Carry out a reform agenda in regional regulations. It is necessary to form an official investor forum and be carried out regularly, and Provincial and district governments should integrate policies and investment development programs (investment) following sectors/sub-sectors and highly competitive commodities in the region