Universal Journal of Pharmaceutical Research
Not a member yet
705 research outputs found
Sort by
THE EFFECT OF DENTAL IMPLANTS ON INCREASING THE COLONIZATION RATE OF AEROBIC BACTERIA IN THE ORAL CAVITY
Get PDFBackground and aims: Dental implants' principal function is to support artificial teeth. The physiological process by which bones firmly adhere to the surface of various ceramics and metals, such as titanium, is what leads to the emergence of modern dental implants, and there may be negative effects of these implants on the balance in the bacterial numbers in the mouth. Therefore, this study compared the colony forming unit (CFU) of oral bacteria from the buccal mucosa and buccal tongue between patients who had dental implants and healthy volunteers without dental implants.
Methods: In this study, 36 people with dental implants and 36 people without dental implants were both included. Following serial dilutions were made and distributed on blood agar, samples were grown in Brain Heart Infusion Broth (BHI). When a single layer of bacteria developed on blood agar at any dilution level, CFU was estimated. Version 7 of Epi-info Statistics software was used to analyze the data. In each graph, the results were presented as mean standard error of the mean (SEM), and in the table, as mean and standard deviation (SD). Collected data were normally distributed and an independent T-test was used to compare different means of oral CFU bacteria between control and test groups of buccal mucosa and lingual mucosa.
Results: For non-implant controls the values for buccal mucosa of bacterial counts were slightly lower than that of the implant patient’s buccal mucosa. There was a significant correlation between the increase of aerobic bacterial colonization of the tongue with the implants where the mean±SD was 196.8±12.9 CFU/ml greater than 183.4±9.1 CFU/ml for the normal controls; indicating the enhancement of the effect of the implant in the heavy colonization of bacteria in the oral cavity among implant patient group (p<0.0001). There was a significant association between ≥5 implants and heavy bacterial colonization of the oral cavity with the mean±SD being 214±13.9 CFU/mL vs. 192.85±4.44 CFU/mL for the two-implant composite patient; p=0.027. Additionally, there was a strong correlation between the duration of 13–24 months since implant placement and decreased bacterial colonization of the oral cavity with the mean±SD being 193.2±10.3 CFU/mL vs. 209.6±13.8 CFU/mL for ≤ 12 months; p=0.005.
Conclusion: Patients with implants had greater lingual buccal tongue CFU readings than non-implant patients, suggesting that implants are more prone to plaque adhesion. Dental implants, particularly those associated with five implants or more and those recently placed, increased the amount of bacteria leading to heavily colonized of the oral cavity.
Peer Review History:
Received: 6 April 2023; Revised: 9 May; Accepted: 27 June 2023; Available online: 15 July 2023
Academic Editor: Dr. Iman Muhammad Higazy, National Research Center, Egypt, [email protected]
Reviewers:
Omnia Momtaz Al-Fakharany, Tanta, University, Eygpt, [email protected]
Dr. Mohaddese Mahboubi, Alzahra University, Tehran, Iran, [email protected]
EXTRACTION OF PECTIN FROM CITRUS SINENSIS FRUIT PEELS AND ITS EFFICIENCY AS A SUSPENDING AGENT
Get PDFAim and objective: The study's objective was to evaluate the performance of Citrus sinensis pectin, which had been extracted and used as a suspending agent during the production of fixed-dose artemether-lumefantrine oral powder for suspension.
Methods: The extracted pectin was used as an excipient to formulate an oral suspension powder of artemether and lumifantrine. Using analytical techniques including Fourier transform infrared (FTIR) and differential scanning calorimetry (DSC), the compatibility of the formulation's constituents, active medicinal ingredients, and extracted pectin was evaluated.
The formulated powder was tested for flow-ability, flow rate, sedimentation rate, re-dispersibility, dissolution rate, and short-term stability.
Results: In several of the batches, the extracted pectin displayed suspending characteristics at concentrations as high as 3.0% w/v. Hausner's and Carr's indices for the created artemether-lumefantrine granules for oral suspension were 30°C, 0.35 g/mL, 0.42 g/mL, 1.20 g/mL, and 15%, respectively. The flow rate was 5.46 g/min, and the suspension's particle size was 7.20 g. The viscosities ranged from 19.50 to 27.20 cP and 12.80 to 21.30 cP at 30 rpm and 60 rpm, respectively. After 80 and 90 minutes, respectively, the dosage forms of artemether and lumefantrine released their respective 75 % w/w medications. Artemether; short-term stability was 91.7±0.01, 91.35±0.00, 90.13±0.02, 89.35±0.03 and 84.70±0.01 at days 0, 30, 60, 90, and 180, respectively. Lumefantrine; short-term stability was also 91.18±0.00, 91.17±0.03, 88.43±0.01, 82.75±0.00, and 81.77±0.02
Conclusion: According to this study, the artemether/lumefantrine oral suspension granules or powder made with the pectin extract had a great suspending effect.
Peer Review History:
Received: 3 June 2023; Revised: 8 July; Accepted: 26 August; Available online: 15 September 2023
Academic Editor: Dr. Muhammad Zahid Iqbal, AIMST University, Malaysia, [email protected]
Reviewers:
Ahmad Najib, Universitas Muslim Indonesia, Makassar, Indonesia, [email protected]
Prof. Ali Gamal Ahmed Al-kaf, Sana'a university, Yemen, [email protected]
Message
Get PDFAs scientists we have all come through a season when the very essence of our beings has been tested by theories, hypothesis, scientific facts known and unknown. We have woken up to a brand-new world where the scientific experimental processes have had to be confirmed again and again. Its post Covid 19 and scientists have stayed strong and bold and convinced of their calling more now than ever before. It is obvious that many studies and investigations have been done by various countries which we will never know about, but many have also been highlighted and put out there so that the world can benefit. I have seen initiatives by African countries push ahead to use what they have and bring them up to the highest of standards. I have attended a meeting organized by WHO (2021) where countries in Africa presented their research as Covid waded along changing form, mutating, and giving scientists more unknowns to investigate. The countries showed progress in scientific research and reporting what progress they had made in coming up with future answers to Covid type infections. I was amazed at how each country had determinedly done so much in such a short time. Many nations had, in collaboration with others come up with natural remedies at various stages of experimentation, research, and clinical trials. I think that the facts of the season had begun to be revealed, that nations were beginning to take their destinies in their hands.
Science in the last two years has been in great dispute and more than everbefore. It is more pertinent that journals be ready to publish scientific facts with good conscience. This is exactly what UJPR did in the last two years, focused on really important areas of science and especially all areas of pharmaceutical science. We have now come to a world where scientists must build on what others have done or are doing in other parts of the world as it is clear no one has all the answers. UJPR has helped connect scientists to one another and it would be interesting to see what relationships have developed through the years directly from the publication.
Covid and all its attendant issues is ongoing and as answers to living healthy are sought for in the world, the part of the world where I come from, Africa are seeking answers from what they have. Some colleagues recently published a paper about the already available medicinal plants which are antiviral, and which could readily be investigated for activity against Covid. This type of publication serves as base information for others to work with and use. Journals in this time will serve as a global information center.UJPR has not failed in its duty to make sure that the highest standard of scientific information has been released over the past years. The quality keeps on improving and content has increased.
I encourage everyone to keep working hard and supporting the editorial team of UJPR. The Journal will keep progressing and we have enough space at the top!!
I keep on congratulating UJPR for taking on the challenge of giving out factual scientific information and being credible. I continue to look forward to the next issues as we build the mountain of knowledge of the world
ANATOMICAL PATTERN COURSE OF MANDIBULAR CANAL AND ITS FORAMINA LOCATION ON SAMPLE OF YEMENI PATIENTS USING CONE BEAM COMPUTED TOMOGRAPHY
Get PDFBackground and aim: Failure of inferior dental anesthesia, increased sensorineural disturbances, and postoperative bleeding in the mandibular canal region has amplified the demand for preoperative planning and appropriate evaluation to prevent these complications. The aim of the study was to reveal the locations and anatomical course pattern of the mandibular canal, as well as the cross-sectional diameter and positions of the mandibular and mental foramina, between a sample of Yemeni patients.
Material and methods: A retrospective descriptive cross sectional study was performed to evaluate 165 CBCT images taken from the archives of Diagnostic Radiology Centers in Sana'a City, using EZ3D plus software. Data were retrieved from February 2017 to January 2021. Recorded data were collected, tabulated and statistically analyzed by SPSS (version 24).
Results: The mean diameter of the mandibular foramen vertical and horizontal were measured to be 4.15±0.84 mm and 3.46±0.71 mm, respectively. The mandibular foramen was located approximately 2.87 mm above the midpoint of vertical ramus and 3.0 mm behind the midpoint horizontally. The mean diameters of the vertical and horizontal mental foramen were measured to be 3.46±0.78 mm, 3.54±1.5 mm, respectively. The mental foramen was located approximately in the middle of the mandibular body vertically. The most common anteroposterior position for the mental foramen was A (HP3) between the first and second premolars of the mandible (50.6%). The most common superior- inferior position for the mental foramen was (VP3) below the level of the root apices of the first and second mandibular premolars (62.2%). The inferio-superior position of the mandibular canal showed that the superior measurements ranged from 12.3-14.4 mm.
Conclusion: This CBCT study reveals differences in the position of the mandibular canal course and the location of the mandibular and mental foramina among Yemeni patients. Therefore, careful evaluation and planning using cone-beam CT before any surgical intervention in the mandibular canal area is highly recommended to avoid unwanted complications among Yemeni patients.
Peer Review History:
Received: 1 December 2022; Revised: 8 January; Accepted: 24 February 2023; Available online: 15 March 2023
Academic Editor: Prof. Dr. Gorkem Dulger, Duzce University, Turkey, [email protected]
Reviewers:
Dr. Bilge Ahsen KARA, Ankara Gazi Mustafa Kemal Hospital, Turkey, [email protected]
Dr. Amany Mohamed Alboghdadly, Princess Nourah bint abdulrahman university, Riyadh, [email protected]
SEROPREVALENCE OF VISCERAL LEISHMANIASIS AND ITS ASSOCIATED FACTORS AMONG ASYMPTOMATIC CHILDREN IN HADHRAMOUT VALLEY AND DESERT REGIONS, YEMEN
Get PDFBackground and Aims: Visceral leishmaniasis (VL) is zoonotic and human illness produced by Leishmania species. Protozoan parasite is spread to the host vertebrate via sand fly female bite (Phlebotomus longipalpis), in which the infected promastigotes convert into amastigotes; and VL is associated with high fatality if left untreated. The aims of the current study were to uncover the prevalence and potential risk factors for VL in children in selected districts of Hadhramout governorate, Yemen.
Subjects and methods: Six districts were randomly selected from 24 districts in Hadhramout governorate as follows: Al-Sum, Al-Qattan, Tarim, Thamud, Seiyun, and Shibam. Then a target sample size of 400 children were randomly selected, 66 children were selected from each district except 70 children in Seiyun and they were selected from the selected schools and health centers. Serum specimens were assemble from all children to determine the rate of anti-VL antibodies in human by immunochromatographic assay using recombinant K39 antigen.
Results: The age of the children from 1-15 years, by a mean of 8.4±2.7 years. The positivity rate of Leishmania species antibodies by immune-chromatographic dipstick strip (rK39) was 5.8%. There was statistically considerable association connecting male gender and VL infection (8.0%, OR=3, CI=1.1-8.2, p=0.02). There was statistically important association linking older children (11-15 years( and contracting VL (9.1%, OR=2.6, CI=1.1- 6.2, p=0.02). There was a considerable association (<0.05) connecting the presence of rats, dogs, and goats in or around live houses and positive VL antibodies with an OR come to to 2.6, 3.7 and 2.8, respectively. There was no significant association between displacement or district location and incidence of VL.
Conclusion: Visceral leishmaniasis was highly prevalent in the desert and the valley areas of Hadramout among children, and visceral leishmaniasis potential risk factors were males, older children, dogs, rats, goats, litter, open sewers, and the presence of sand flies in the household.
Peer Review History:
Received: 6 October 2022; Revised: 12 November; Accepted: 25 December 2022, Available online: 15 January 2023
Academic Editor: Dr. Nuray Arı, Ankara University, Turkiye, [email protected]
Reviewers:
Dr. Bilge Ahsen KARA, Ankara Gazi Mustafa Kemal Hospital, Turkey, [email protected]
Rola Jadallah, Arab American University, Palestine, [email protected]
KNOWLEDGE OF HEALTHCARE PROVIDERS IN EXPANDED PROGRAM ON IMMUNIZATION, SA’ADAH, YEMEN
Get PDFBackground: After achieving high vaccination coverage, vaccine failure may occur. The sufficient knowledge of the workers in the expanded program of immunization (EPI) is one of the factors that affect in preventing this failure. In Saada, Yemen, there is no information about the knowledge of workers in the EPI. This study seeks to assess the knowledge of those in charge of immunization in Sa’adah, Yemen.
Method: This prospective cross-sectional study was performed to assess healthcare providers (HCPs) knowledge regarding EPI. It was conducted on 60 HCPs in 60 H.F of 11 districts in Sa’adah Governorate, Yemen during 1 June – 30 July 2019. Appropriate interviewing pre-tested questionnaire was used to collect data from HCPs working in EPI. It includes the following: socio-demographic characteristics, knowledge about; cold chain and the method and time of administration of the vaccine and shake test. Face to face interview used to collect information. Data entering and cleaning were done using Microsoft Excel 2019 and exported to SPSS version 26, p-value less than 0.05 were considered significant. Differences in samples means were evaluated by chi-square test.
Results: Age is one of the determining factors for knowledge of cold chain management (FET=0.040*), and the total knowledge score for of HCPs was (26.7%, 65%, and 8.3%) for good, fair, and poor knowledge, respectively.
Conclusion: Only twenty-six-point seven of HCPs had a good knowledge score. Constant technical support and on job training to improve the HCPs knowledge about immunization are extremely recommended.
Peer Review History:
Received: 2 December 2022; Revised: 8 January; Accepted: 24 February 2023; Available online: 15 March 2023
Academic Editor: Dr. Emmanuel O. Olorunsola, Department of Pharmaceutics & Pharmaceutical Technology, University of Uyo, Nigeria, [email protected]
Reviewers:
Dr. Muhammad Zahid Iqbal, AIMST University, Malaysia, [email protected]
Dr. Olanrewaju Rita-Marie Awotona, Legacy University, Banjul , The Gambia, [email protected]
Rola Jadallah, Arab American University, Palestine, [email protected]
ASSESSMENT OF THE PRESENT BACTERIOLOGICAL PROFILE AND ANTIBIOTIC SENSITIVITY PATTERN IN CHRONIC SUPPURATIVE OTITIS MEDIA IN SANA’A, YEMEN
Get PDFBackground and objectives: The drainage of pus from the ear through a ruptured tympanic membrane that lasts longer than 12 weeks is known as chronic suppurative otitis media (CSOM). The purpose of the study was to ascertain the microbiological profile of middle ear chronic inflammation (CSOM) and the isolates' susceptibility to locally accessible antibiotics.
Subjects and methods: Total 111 ear swab samples from patients with clinically confirmed active CSOM were used in this cross-sectional investigation. Following a standard protocol, ear swabs were cultured to identify microbes. A modified Kirby-Bauer disk diffusion method was used to test antibiotic susceptibility, and the Clinical Laboratory Standards Institute's guidelines were followed to determine the diameter of the zone of inhibition.
Results: During two years, 111 patients with chronic suppurative otitis media were collected from January 2020 to the end of December 2022. Most of the patients were males (63.96%) while females were 36.04%. 36.04% of the total patients were in the ≤10-year group, and 29.7% were in the ≥46-year group while the other age groups were less frequent. Microbial growth was seen in 91.9% of samples, but 7.2% of samples did not. Among the samples with growth, 71.2% were monomicrobial, 12.6% were polymicrobial, and 9% had mixed growth with more than three microorganisms. The most frequently isolated bacteria were Pseudomonas aeruginosa (34.95%) followed by Staphylococcus aureus (14.6%) and Klebsiella spp. (9.8%). The antibiotics most sensitive against P. aeruginosa were cefepime (97.7%), meropenem (95.3%), piperacillin-tazobactam (95.3%), and ciprofloxacin (93%). Staphylococcus aureus showed the highest sensitivity to rifampin (100%) and fusidic acid (88.9%).
Conclusion: In the bacteriological profile of CSOM, P. aeruginosa, S aureus, Klebsiella spp., and Acinetobacter spp. are highly prevalent. The distribution of CSOM varies depending on the age group. The antibiotic susceptibility pattern of the bacterial isolates decreased. It is critical to review antibiotic prescriptions based on susceptibility and to be informed of the current trend in bacteriological profiles.
Peer Review History:
Received: 7 August 2023; Revised: 9 September; Accepted: 26 October; Available online: 15 November 2023
Academic Editor: Dr. Iman Muhammad Higazy, National Research Center, Egypt, [email protected]
Reviewers:
Dr. Tamer Elhabibi, Suez Canal University, Egypt, [email protected]
Dr. Bilge Ahsen KARA, Ankara Gazi Mustafa Kemal Hospital, Turkey, [email protected]
Dr. Wadhah Hassan Ali Edrees, Hajja University, Yemen, [email protected]
CONFORMATIONAL STUDY OF MOLECULES IN A BIOLOGICAL ENVIRONMENT, DESIGN OF INHIBITORS OF HUMAN AMINOPEPTIDASE M1 IMPLICATED IN CANCER THERAPY
Get PDFObjective: A novel subnanomolar anticancer hydroxamic acid containing drug candidates, inhibitors of human M1 aminopeptidase (APN) a recent validated target and has reached the predicted subnanomolar range of inhibitory potency.
Methods: A quantitative structure activity relationships (QSAR) complexation model has been developed from a compounds of 37 hydroxamic acid derivatives (AHD1-37 as training set, TS) to establish a linear correlation between the calculated relative Gibbs free energies (GFE: ΔΔGcom) of APN-AHDx complex formation and the experimental inhibition potency (Kiexp). The predictive power of the QSAR model was then validated first with 9 other AHDs not included in the TS and thereafter with the generation of a 3D-QSAR-PH4 pharmacophore (PH4) model to screen the AHD chemical subspace built as a virtual combinatorial library of more than 58,644 AHD analogs). Finally the best PH4 hits were evaluated with the initial QSAR model for predicted potency (Kipre) and pharmacokinetic profile.
Results: The QSAR model linear correlation equation: pKiexp=-0.1901×∆∆Gcom + 8.2886 , R2=0.94, the subsequent PH4 model linear correlation between experiment and PH4-estimated Ki: pKiexp=1.0006× pKipre + 0.0028, R2=0.79 documents the high predictive power of this approach. Finally the screening of the virtual library of AHD analogs yielded 95 orally bioavailable candidates the best reaching a predicted potency (Kipre) of 50 pM and displaying favorable pharmacokinetic profile.
Conclusion: The combined use of molecular modeling (QSAR) and in silico PH4-based screening of the hypothetical combinatorial library has resulted in proposed and predicted potent anticancer candidates with a suitable pharmacokinetic profile.
Peer Review History:
Received: 8 August 2023; Revised: 3 September; Accepted: 29 October; Available online: 15 November 2023
Academic Editor: Dr. Nuray Arı, Ankara University, Turkiye, [email protected]
Reviewers:
Prof. Hassan A.H. Al-Shamahy, Sana'a University, Yemen, [email protected]
Prof. Dr. A. Hakan AKTAŞ, Süleyman Demirel University, Faculty of Science and Art, Department of Chemistry, Isparta-Turkey, [email protected]
PHYTOCHEMISTRY OF THE EXTRACTED PECTIN FROM CITRUS SINENSIS FRUIT PEELS
Get PDFAim and objective: Pectin, a natural polymer, is often extracted from Citrus sinensis fruit peels under slightly acidic circumstances. It is a multipurpose pharmaceutical excipient that has been researched for its possible use in oral solid dosage forms. The study's goal was to describe the pectin that was extracted from Citrus sinensis fruit peels.
Methods: Pectin was produced using acidified water and a Soxhlet apparatus. Following phytochemical screening, the extracted pectin was calculated for its micromeritics properties, flow behavior, viscosity, and swelling index, utilize an acidified water-based extraction technique.
Results: Total 8.00% yield was achieved when producing pectin. The phytoconstituents of the extracted pectin include carbohydrate, protein, alkaloids, and mucilage. The organoleptic properties of the extracted pectin include; brownish, odorless, orange juice taste, amorphous powder with melting point of 151ºC. The extracted pectin from C. sinensis fruit peel showed good flow properties (angle of repose: 29±02), an ash value of 2.03 percent by weight, and a loss on drying of 0.70 percent was discovered. The pH was found to be 3.5, suggesting that it may be consumed orally without any irritation. Extracted pectin was soluble in methanol, hydrochloric acid, and warm water. It formed lumps in cold water and was insoluble in certain organic solvents including ethanol, acetone, and alkali.
Conclusion: The outcomes of the evaluated parameters showed that pectin from the C. sinensis plant's peel might be used as a pharmaceutical excipient to make solid oral dosage forms such tablets and powder for oral suspension.
Peer Review History:
Received: 1 June 2023; Revised: 7 July; Accepted: 24 August; Available online: 15 September 2023
Academic Editor: Prof. Cyprian Ogbonna ONYEJI, Obafemi Awolowo University, Ile-Ife, Nigeria, [email protected]
Reviewers:
Ali Jaber, Laboratory for Research and Development of Medicines and Natural Products, RDMPN, Faculty of Pharmacy, Lebanese University, Beirut, Lebanon, [email protected]
Prof. Hüsniye Kayalar, Ege University, Turkey, [email protected]
PREVALENCE OF TETRACYCLINE RESISTANCE GENES IN ESCHERICHIA COLI ISOLATED FROM FOOD SAMPLES IN AND AROUND MICHAEL AND CECILIA IBRU UNIVERSITY, NIGERIA
Get PDFBackground: Genes that confer resistance to tetracycline, a common antibiotic used in both human and veterinary medicine, are among the antibiotic resistance genes of most concern. Tetracycline treatment, a crucial weapon in the fight against bacterial infections, can become ineffective because of this resistance.
Aim: Determination of the prevalence of tetracycline resistance genes within Escherichia coli strains found in food samples obtained from local food vendors in and around Michael and Cecilia Ibru University, Agbarha-Otor.
Methods: Food samples were obtained from 6 out of 10 selected food vendors in and around MCIU campus. A total sample size of 100 respondents were administered questionnaires. Out of a total food sample size of 28, about 25grams of food samples were homogenized with 225 ml of buffered peptone water (BPW) in an electric blender (Vitamix 5200 model). Eosin Methylene Blue (EMB) agar was subsequently used as the culture media. About 0.5 ml aliquots of the inoculum were taken to extract DNA by the modified Boiling Lysis Method. Polymerase Chain Reaction (PCR) was performed using a thermocycler for the detection of tetA gene in E. coli isolates using specific primers (tetA-F CGCCTTTCCTTTGGGTTCTCTATATC; tetA-R CAGCCCACCGAGCAC AGG; Size=182 base pairs). Thereafter, gel electrophoresis was done at 200 volts for 15 minutes and studied under UV light Gel Documentation System (Cleaver Scientific, UK). Statistical analysis was conducted using Chi-square tests to identify significant differences (p<0.05) in resistance patterns among the food categories.
Results: Tetracycline resistant gene (tetA) was investigated among 18 of 28 cultured samples which had E. coli growth indicating 64% prevalence. Electrophoresis results indicated the presence of tetA gene in 11 out of the 18 E. coli positive samples as the prevalence of tetA gene was 61%. Lane 2, 4, 5, 6, 7, and 10 showed bands at 182 bp confirming the isolate contained tetA gene. Lane 5 showed additional bands at 780 bp which indicated possible superficial polymorphism of the tetA gene in isolates. The presence of bands at 182 bp confirmed the presence of the gene, and the presence of additional bands at 780 bp in Lane 5 suggested potential genetic variation in the tetA gene.
Conclusion: The study contributes to a broader understanding of antibiotic resistance patterns, gene prevalence, and genetic variations in bacterial isolates, with particular reference to E. coli. It underscores the need for continued surveillance and research into antimicrobial resistance, particularly in environments where E. coli contamination is of concern, such as food vendor settings.
Peer Review History:
Received: 1 June 2023; Revised: 7 July; Accepted: 24 August; Available online: 15 September 2023
Academic Editor: Dr. A.A. Mgbahurike, University of Port Harcourt, Nigeria, [email protected]
Reviewers:
Prof. Hassan A.H. Al-Shamahy, Sana'a University, Yemen, [email protected]
Dr. Bilge Ahsen KARA, Ankara Gazi Mustafa Kemal Hospital, Turkey, [email protected]