2,204 research outputs found
Cultural identities as reflected in the literature of the Northern and Southern dynasties period (4th-6th centuries A.D.)
During the period of the Northern and Southern dynasties of China identity questions became serious in a society thrown into disorder by political, religious and ethnic problems. This thesis uses three books written in the sixth century to
discuss how educated Chinese faced identity problems and how they dealt with them.
The Buddhist monk Huijiao, dealt with the problems of sinifying a foreign religion. He constructed many different identities in addition to the Buddhist one for the monks in his book Gaoseng zhuan, (Lives of Eminent Monks), a collection of biographies of Buddhist monks, to bring Buddhism closer to Chinese tradition and more acceptable by Confucian standards. Through the identity construction he
also made responses to anti-Buddhist ideas.
Yang Xuanzhi's Luoyang qielan ji, (Record of the Monasteries of Luoyang), deals with the identity problems of Chinese officials serving a Xianbei regime in
the north and of the short-lived capital of the Northern Wei in Luoyang. Yang reconstructed a Chinese identity for the lost capital as a true heir of Chinese tradition, as were the emperors, princes and officials who lived there. He created an identity defined not by ethnicity but by culture.
Yan Zhitui's Tanshi jiaxun, (Family Instruction of the Yan Clan), is a book which tells his descendants how to construct and maintain the future identity of his
own family. He drew on his own experience of recovering from repeated political catastrophes to set out an identity that would help the family to survive disordered times and maintain their status in society
Summer and winter distribution and malformation of coccolithophores in the East China Sea
The FJ-Curve of the 20 bp sequence ‘GCCTCCGCCCAGACTTCTTC’.
<p>The FJ-Curve of the 20 bp sequence ‘GCCTCCGCCCAGACTTCTTC’.</p
Placenta growth factor elevation in the cord blood of premature neonates predicts poor pulmonary outcome
Vascular endothelial growth factor in preterm infants with respiratory distress syndrome
Outcomes in NG feeding compared with FJ feeding in linear regression.
Outcomes in NG feeding compared with FJ feeding in linear regression.</p
Odds ratio for outcomes in NG feeding compared with FJ feeding in logistic regression.
Odds ratio for outcomes in NG feeding compared with FJ feeding in logistic regression.</p
Exploring the Business Crisis Management of Direct Selling Establishment: FJ Company Distributors\ue2 Perspective
Abstract
Direct selling establishment has suffered the change of market environment in the decade. The uncertainty of market structure and environment would cause the risks for business development. Direct selling establishments would develop their own business models and market strategies in order to maintain their organization capacity and market niche. Many businesses have emphasized on the importance of crisis management on business development; however, few has realized on what the crisis issues that business may have. This study applied crisis management theory and adopted survey to examine how the distributors perceive crisis issues of FJ direct selling establishment. In addition, this study discussed the major challenges in business crisis management and may point out suggestions with future development.
Keyword: risk management, business model, strategy management, sustainable development, social responsibilit
Distribution of gender and comorbidities between the NG and FJ feeding groups.
Distribution of gender and comorbidities between the NG and FJ feeding groups.</p
Homology Modeling of Toll-Like Receptor Ligand-Binding Domains
Toll-like receptors (TLRs) are in the front-line during the initiation of an innate immune response against invading pathogens. TLRs are type I transmembrane proteins that are expressed on the surface of immune system cells. They are evolutionarily conserved between insects and vertebrates. To date, 13 groups of mammalian TLRs have been identified, ten in humans and 13 in mice. They share a modular structure that consists of a leucine-rich repeat (LRR) ectodomain, a single transmembrane helix and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain. Most TLRs have been shown to recognize pathogen-associated molecular patterns (PAMPs) from a wide range of invading agents and initiate intracellular signal transduction pathways to trigger expression of genes, the products of which can control innate immune responses. The TLR signaling pathways, however, must be under tight negative regulation to maintain immune balance because over-activation of immune responses in the body can cause autoimmune diseases.
The TLR ectodomains are highly variable and are directly involved in ligand recognition. So far, crystal structures are missing for most TLR ectodomains because structure determination by X-ray diffraction or nuclear magnetic resonance (NMR) spectroscopy experiments remains time-consuming, and sometimes the crystallization of a protein can be very difficult. Computational modeling enables initial predictions of three-dimensional structures for the investigation of receptor-ligand interaction mechanisms. Computational methods are also helpful to develop new TLR agonists and antagonists that have therapeutic significance for diseases.
In this dissertation, an LRR template assembly approach for homology modeling of TLR ligand-binding domains is discussed. To facilitate the modeling work, two databases, TollML and LRRML, have been established. With this LRR template assembly approach, the ligand-binding domains of human TLR5-10 and mouse TLR11-13 were modeled. Based on the models of human TLR7, 8 and 9, we predicted potential ligand-binding residues and possible configurations of the receptor-ligand complex using a combined procedure. In addition, we modeled the cytoplasmic TIR domains of TLR4 and 7, the TLR adaptor protein MyD88 (myeloid differentiation primary response protein 88) and the TLR inhibitor SIGIRR (Single immunoglobulin interleukin-1 receptor-related molecule) to investigate the structural mechanism of TLR negative regulation
- …
