1,725 research outputs found
“Viva, Maria — a mais bonita!” de Luana Passos: realismo animista na literatura negro-brasileira contemporânea
No full textThis article proposes a reading of the short story “Viva, Maria — a mais bonita!” by Luana Passos (2021), based on the concept of animist realism, as formulated by Harry Garuba (2012), and developed by Providence Bampoky (2022). The analysis highlights how the narrative reintegrates elements of African and Afro-Brazilian culture, recreating experiences of healing, displacement and ancestry based on a poetics of (re)enchantment. Also articulating the studies of William Clyde Ford (1999), Conceição Evaristo (2009) and Luana Passos (2024), the literary gesture of Luana Passos is discussed as the construction of a black aesthetic of resistance, capable of breaking with the colonial paradigms of Western literary criticism. The article defends the need to incorporate animist realism into Brazilian literary studies as a critical category that contemplates Afrocentric epistemologies and other ways of narrating the world.O presente artigo propõe uma leitura do conto “Viva, Maria — a mais bonita!”, de Luana Passos (2021), a partir do conceito de realismo animista, conforme formulado por Harry Garuba (2012) e desenvolvido por Providence Bampoky (2022). A análise evidencia como a narrativa reintegra elementos da cultura africana e afro-brasileira, recriando experiências de cura, deslocamento e ancestralidade a partir de uma poética de (re)encantamento. Articulando também os estudos de William Clyde Ford (1999), Conceição Evaristo (2009) e Luana Passos (2024), discute-se o gesto literário de Luana Passos, autora do conto, como construção de uma estética negra de resistência, capaz de romper com os paradigmas coloniais da crítica literária ocidental. O artigo defende a necessidade de incorporar o realismo animista aos estudos literários brasileiros, como categoria crítica que contempla epistemologias afrocentradas e formas outras de narrar o mundo
Leandro Castelluccio – Complete Works Archive
No full textThis repository preserves the essential body of work of Leandro Castelluccio—author, psychologist, cognitive neuroscientist, and thinker—whose writings explore the intersections between philosophy, consciousness, ethics, psychology, and neuroscience.
The purpose of this archive is twofold. First, to ensure long-term open access to these works as a cultural and intellectual contribution available to all, beyond technological platforms, institutional constraints, or temporal limitations. Knowledge, at its best, belongs to everyone and transcends the contingencies of the moment.
Second, this archive invites a living intellectual dialogue. Ideas evolve when they are read, re-interpreted, questioned, and expanded upon. The works preserved here are offered not as static monuments, but as open spaces for reflection and co-creation—where new interpretations, studies, and philosophical developments may emerge through time.
This project is organized into curated components that group books, essays, and research publications. All materials reflect final or published versions intended for public and scholarly reference
A regra dos três passos: uma baliza para as limitações aos direitos autorais
No full textApresenta a regra dos três passos, um mecanismo de apoio para a utilização de pequenos trechos de obras intelectuais. Vídeo da atividade 4, unidade 2, do Curso de Direitos Autorais, ofertado pela Universidade Aberta do SU
A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil
No full textBartlett, Charles R., Passos, Eliana Maria Dos, Silva, Flaviana Gonçalves Da, Diniz, Leandro Eugenio Cardamone, Dollet, Michel (2018): A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil. Zootaxa 4472 (2): 358-364, DOI: 10.11646/zootaxa.4472.2.
A CORAGEM DE DANSO DE KIUSAM OLIVEIRA: LITERATURA NEGRO BRASILEIRA PARA AS INFÂNCIAS E TIPOLOGIA TEXTUAL NARRATIVA
No full textEste artigo analisa os elementos e a estrutura da tipologia textual narrativa da obra A Coragem de Danso (2024) de Kiusam Oliveira, ilustrada por Paulica Santos, enfatizando como o “drama/conflito” do texto é construído de forma elíptica. Argumenta-se que essa estratégia se configura como uma poética literária negro-brasileira que se torna coerente para crianças e jovens. Para tanto, utilizam-se como fundamentação teórica os estudos de Bazerman (2020) sobre gênero e tipologia textual, Luís Silva Cuti (2010) sobre Literatura Negro-brasileira, e Luana Passos (2024) sobre Ginga Literária e a Linguagem Kiusamiana. A obra representa uma narrativa significativa no contexto da literatura infantil e juvenil negro-brasileira, evidenciando a preocupação das mães negras brasileiras com o futuro de seus filhos
FIGURES 9–11 in A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil
No full textFIGURES 9–11. Oecleus sergipensis, male terminalia; 9, terminalia, left lateral view; 10, aedeagus and flagellum, right lateral view; 11, phallotheca apex and flagellum, caudal view.Published as part of Bartlett, Charles R., Passos, Eliana Maria Dos, Silva, Flaviana Gonçalves Da, Diniz, Leandro Eugenio Cardamone & Dollet, Michel, 2018, A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil, pp. 358-364 in Zootaxa 4472 (2) on page 362, DOI: 10.11646/zootaxa.4472.2.8, http://zenodo.org/record/144024
MATERNIDADE PRETA E REALISMO ANIMISTA EM CONCEIÇÃO EVARISTO
No full textThis article analyzes the short story “Os Guris de Dolores Feliciana” by Conceição Evaristo through the lenses of animist realism and Black motherhood. Utilizing Harry Garuba’s concepts of animist realism and Muniz Sodré’s ideas, this study explores how the integration of spiritual and ancestral elements forms a narrative where the spiritual and material are intertwined, reflecting the protagonist’s reality and her relationship with the memory of her lost children. The analysis also addresses the concept of “literary ginga” by Luana Passos (2024), expressing a fluid and dynamic movement characteristic of Black Brazilian literature, incorporating aspects of ancestry, rhythm, and orality. By emphasizing cultural resilience and the preservation of Black memory, Evaristo’s narrative emerges as a denunciation of racial violence faced by Black Brazilian women. The text also draws upon the ideas of Luiz Silva (Cuti, 2010), reinforcing the need for a literary critique that values the specificity of Black Brazilian literature and promotes the visibility of characters and experiences often marginalized in traditional literature.Este artigo analisa o conto “Os Guris de Dolores Feliciana”, de Conceição Evaristo, por meio das perspectivas do realismo animista e da maternidade negra. Utilizando os conceitos de Harry Garuba sobre o realismo animista e de Muniz Sodré, o estudo discute como a integração de elementos espirituais e ancestrais cria uma narrativa em que o espiritual e o material se entrelaçam, refletindo a realidade da protagonista e sua relação com a memória dos filhos perdidos. A análise aborda ainda a “ginga literária”, conceito de Luana Passos (2024), que expressa um movimento fluido e dinâmico característico da literatura negro-brasileira, integrando aspectos de ancestralidade, ritmo e oralidade. Ao valorizar a resistência cultural e a preservação da memória negra, a narrativa de Evaristo configura-se como uma denúncia das violências raciais enfrentadas pelas mulheres negras brasileiras. O texto também se fundamenta nas ideias de Luiz Silva (Cuti, 2010), reforçando a necessidade de uma crítica literária que valorize a especificidade da literatura negro-brasileira e promova a visibilidade de personagens e experiências frequentemente marginalizadas na literatura tradicional
Oecleus sergipensis Bartlett & Passos & Silva & Diniz & Dollet 2018, n. sp.
No full textOecleus sergipensis n. sp. (Figures 1–12) Type locality. Itaporanga D’Ajuda, Sergipe, Brazil. Diagnosis. A pale species, ~ 5–6 mm, with 5 carinae on the mesonotum and a projected head. Male terminalia with a broad, rounded ventral lobe of the pygofer, 3 processes on the phallotheca (2 subbasal—1 on each side—and one near midlength on right side), and 5 flagellar processes. Anal tube very broad and truncate apically, strongly concave ventrally. Description. Color. Ground color of body tan to yellowish-white (Figs. 1–3); legs brownish white; wings clear. Structure. Body length (including wings) males x‾= 5.19 mm (4.69–5.57 mm, n=5); females x‾= 5.56 mm (5.18–5.82 mm, n=3). In lateral view, head prolonged about 2/3 length of eyes, acutely pointed, and slightly inclined distally (Fig. 5). Eyes oval, long axis approximately parallel to vertex, distinctly emarginate near antennae. Vertex narrow (Fig. 1), median carinae absent, lateral carinae closely approximated between eyes, distinctly broader distally; apex of head with carina at fastigium. Ocelli present with lateral ocelli below eyes, median just above midline of frontoclypeal suture on median carina of frons. Face with frons elongate (Fig. 3), narrowing slightly from frontoclypeal suture to fastigium; median carinae evident from frontoclypeal suture to above eyes where it becomes obsolete; clypeus with median carina present. Pronotum with anterior margin weakly concave, posterior margin deeply "U" shaped, medially very short and obscuring median carina; lateral carinae diverging, poorly developed. Mesonotum midline longer than head plus pronotum; bearing 5 pale carinae, 3 distinct, lateralmost weak; all nearly straight and approximating posterior mesonotum margin. Wings clear (Fig. 4), veins embrowned with conspicuous pustules. Combined veins Sc+R+MP with long stem extending from leading margin of the basal cell (Fig. 12); Sc+R branched from MP at about 1/3rd length of clavus; combined veins Sc+R with 5 branches reaching wing margin, MP with 5 terminals; CuA apparently with 2 branches; PCu joining with A1 near midlength of clavus (distad of fork of Sc+R and MP). Male terminalia. Pygofer in lateral view distinctly elongate ventrally and strongly narrowing dorsally (Figs. 6, 9). Median lobe of pygofer broad in ventral view narrowing distally, rounded apically. Phallotheca with 3 processes (Figs. 6, 8, 9–11), one elongate process just beyond mid-length of phallotheca laterally projected from right side and a pair of subbasal projections closely oppressed to the phallotheca; flagellum (endosoma) with 5 elongate processes—1 apical, 2 subapical on right side; 2 subbasal (one on each side). Anal tube in lateral view strongly concave ventrally, distally very broad, apex in lateral view truncate with slight concave emargination. Note. Compared to species illustrated by Caldwell (1944), O. sergipensis would appear to be closest to O. pellucens Fowler 1904, but differs most obviously in that O. sergipensis has an anal tube that is broader distally, a broader and more regularly tapered ventral process on the pygofer, and the presence of a process near the middle of the phallotheca on the right side in O. sergipensis (longer and apical in O. pellucens). Plant associations: Arecaceae: coconut (Cocos nucifera L.) and date palm (Phoenix L). Distribution: Brazil (Sergipe). Etymology. The specific name is a reference to Sergipe State in Brazil where the species was detected, and the name is considered indeclinable. Specimens examined. Holotype male “ Brazil, Sergipe / Itaporanga D'Ajuda, / Eliana Passos; 19 April 2016 / Aspirated from Coconut // Holotype / Oecleus sergipensis / Bartlett & Passos”; Paratypes, Itaporanga D’Ajuda [26 November 2015] (4 males, 1 female, MPEG), Itaporanga D’Ajuda [26 November 2015] (4 males, 1 female, CPATU); Neópolis [17 December 2015] (3 males, MPEG); Aracaju [23 November 2015] (10 males) [representatives used for molecular analysis]). Sequence data. A total of 587 bp of CO1 sequence data was obtained and accessioned to GenBank (Accession No.: MH266780). The available sequence data on GenBank does not include homologous sequence data for Oecleus. The closest match for the sequence data using a BLAST search was Haplaxius crudus (accession HM017492.1) with an 83% identity and 82% query coverage match. This match supports a tribal level relationship among Oecleus and Haplaxius, but also demonstrates that no similar sequence data is present in GenBank for Oecleus. The sequence data obtained in this study is given as follows (5’–3’): ccaaaaaacttatatcctcatcctaccagggtttggcttaatctctcatatcattatgcaagaaacaggtaaaaaggaaacatttggatcaatcggaataatttatgcaataa ttgcaattggagcattagggtttgtcgtatgagcacatcatatattcacagtaggaatagacattgatacccgagcttactttacatcagcaaccataatcatcgcagtacc aactggaattaaaatttttagatgaatagcaaccatatacggaacaaaaataaagttttcacctcaaatactatgagcatcaggatttgtatttttattccccatgggcggatt aacaggagtaatcttagccaattcatcaattgacatcatccctacatgacccatactatgtagttgcacattttttttttcgtattatcaataggagccccattccctcttatagg aagattcatccactgctaccccctattccccacgaatatacccaaaaaaaaaaggattactacttccccccctcctaatatttacaggagccccccttatccttttcccccc ccccttcttaccaagccctc Remarks. In Kramer (1977), this species might key between Oecleus rhion Kramer, 1977 and O. piperatus Ball & Klingenberg, 1935, if the direction of “shaft [phallotheca] with acute projection on right side near base or middle” is followed; however, O. sergipensis bears little resemblance to these species and the projection on the phallotheca is different in nature from those illustrated by Kramer (1977) for those two species. Ignoring this, Kramer’s key at couplet 5 might be followed in the direction of ‘[aedeagal] shaft with three processes’, except that in all cases, the processes are near the apex of the phallotheca; ignoring these, O. sergipensis might key to Oecleus snowi Ball, 1905, which is similar in that it is a ‘tawny’ species (as opposed to black); however, O. snowi is a large species (Kramer reported males 6.0–7.0 mm., females 7.0– 8.5 mm), and differs from O. sergipensis in many details. None of the species illustrated in Caldwell (1944) show subbasal processes on the phallotheca of the aedeagus.Published as part of Bartlett, Charles R., Passos, Eliana Maria Dos, Silva, Flaviana Gonçalves Da, Diniz, Leandro Eugenio Cardamone & Dollet, Michel, 2018, A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil, pp. 358-364 in Zootaxa 4472 (2) on pages 360-363, DOI: 10.11646/zootaxa.4472.2.8, http://zenodo.org/record/144024
A voz e vez da redação: Relatos acerca da trajetória de formação do telejornalista brasileiro - Parte 4 – Paulo Roberto Leandro
No full texto jornalista Paulo Roberto Leandro formou-se em Jornalismo na primeira turma da Escola de Comunicações da USP. Trabalhou em diversas redações e emissoras de televisão como a TV Tupi, exercendo as funções de editor de texto, editor regional, e como diretor de jornalismo da TV Globo em São Paulo durante seis anos. Até 2015 trabalhava na Rede TV! Como consultor e um dos principais editores, da gestão de Franz Vacek. Em entrevista gravada no dia 9 de novembro de 2006, o jornalista contou um pouco de sua formação e de sua trajetória pelo telejornalismo
Apresentação do Dossiê Os primeiros passos dos escritos em línguas vernáculas
No full textTexto de apresentação do Dossiê Os primeiros passos dos escritos em línguas vernáculas - V.5, N.1, 2016
- …
