735 research outputs found
Medical Entomology: Education and Research in India
No full textArticle Type: Editorial
Title: Medical Entomology: Education and Research in India
Year: 2023; Volume: 3; Issue: 2; Page No: 1 – 3
Author: Jayanthi Sureshbabu*
https://doi.org/10.55349/ijmsnr.20233213
Affiliation: Editor-In-Chief, International Journal of Medical Sciences and Nursing Research, Coimbatore, Tamil Nadu, India and Former Lecturer in Medical Entomology, Department of Community Medicine, Pondicherry Institute of Medical Sciences, Kalapet, Pondicherry, India.
Email ID: [email protected]
Article Summary: Submitted: 20-April-2023; Revised: 20-May-2023; Accepted: 5-June-2023; Published: 30-June-2023Editorial Article by Editor-In-Chie
SIGNAL PROCESSING OF EEG WAVES USING CONVOLUTIONAL NEURAL NETWORK
No full textN. Jayanthi,G. Gayathir
Importance and Need of Medical Entomology and Medical Entomologist in Public Health
No full text<p><strong>Article Type: </strong><strong>Editorial</strong></p>
<p><strong>Importance and Need of Medical Entomology and Medical Entomologist in Public Health</strong></p>
<p><strong>Year: </strong>2023; <strong>Volume: </strong>3;<strong> Issue: </strong>3;<strong> Page No: </strong>1 – 2</p>
<p><strong>Author: Jayanthi Sureshbabu</strong></p>
<p><strong>Affiliation:</strong> Editor-In-Chief, International Journal of Medical Sciences and Nursing Research, Coimbatore, Tamil Nadu, India and Former Lecturer in Medical Entomology, Department of Community Medicine, Pondicherry Institute of Medical Sciences, Kalapet, Pondicherry, India.</p>
<p><strong>Email ID: </strong> <a href="mailto:[email protected]">[email protected]</a></p>
<table>
<tbody>
<tr>
<td><strong>How to cite this article: </strong>Sureshbabu J. Importance and Need of Medical Entomology and Medical Entomologist in Public Health. Int J Med Sci and Nurs Res 2023;3(3):1–2.</td>
</tr>
</tbody>
</table>
<p><strong>Article Summary: Submitted: </strong>20-July-2023; <strong>Revised: </strong>18-August-2023; <strong>Accepted: </strong>05-September-2023; <strong>Published: </strong>30-September-2023</p>
<p>DOI: https://doi.org/10.55349/ijmsnr.20233312</p>Editorial Articl
Compulsive methamphetamine taking in the presence of punishment is associated with increased oxytocin expression in the nucleus accumbens of rats
No full textAbstractMethamphetamine addiction is mimicked in rats that self-administer the drug. However, these self-administration (SA) models do not include adverse consequences that are necessary to reach a diagnosis of addiction in humans. Herein, we measured genome-wide transcriptional consequences of methamphetamine SA and footshocks in the rat brain. We trained rats to self-administer methamphetamine for 20 days. Thereafter, lever-presses for methamphetamine were punished by mild footshocks for 5 days. Response-contingent punishment significantly reduced methamphetamine taking in some rats (shock-sensitive, SS) but not in others (shock-resistant, SR). Rats also underwent extinction test at one day and 30 days after the last shock session. Rats were euthanized one day after the second extinction test and the nucleus accumbens (NAc) and dorsal striatum were collected to measure gene expression with microarray analysis. In the NAc, there were changes in the expression of 13 genes in the SRvsControl and 9 genes in the SRvsSS comparison. In the striatum, there were 9 (6 up, 3 down) affected genes in the SRvsSS comparison. Among the upregulated genes was oxytocin in the NAc and CARTpt in the striatum of SR rats. These observations support a regional role of neuropeptides in the brain after a long withdrawal interval when animals show incubation of methamphetamine craving.</jats:p
Exploiting synteny between oil palm and rice to find markers more closely linked to selected trait
No full textThe African oil palm (Elaeis guineensis) and rice (Oryza sativa) are important economic crops. The rice genome has been more extensively characterised and studied compared to oil palm. GBrowse, a bioinformatics tool for visualising genomic and other sequences along a reference genome was applied in this study. Herein, we report the use of model organism Oryza sativa as a reference genome to map 75 463 genomic E. guineensis sequences. A subset of 328 oil palm sequences that aligned well to the 12 rice chromosomes was shortlisted for further analysis. Of these 328 genomic sequences, 261 contained microsatellite motifs and were apt for primer design. A total of 208 Simple Sequence Repeats (SSR) were selected to screen for polymorphism in a subset of palms from a selfed Nigerian tenera mapping population (T128), whereby, 67 SSR were found to be polymorphic. Thirty-eight of the polymorphic markers were mapped onto the genetic map. In comparison to the 12 rice chromosomes, six SSR from the oil palm linkage group 1 (LG1), containing the shell gene (SH) locus were identified on chromosomes 2 and 5 of rice. The order of these six SSR on linkage group 1 was mostly similar to that in chromosomes 2 and 5 of rice. The study provided evidence on synteny between oil palm and rice and facilitated the mapping of a marker closer to SH locus
Megaselia sepsioides Srivathsan & Hartop & Puniamoorthy & Lee & Kutty & Kurina & Meier 2019, sp. n.
No full textMegaselia sepsioides Hartop sp. n. urn:lsid:zoobank. org:pub: ED268DF2-A886-4C31-A4FB-6271C382DECE DNA barcode for UGC0005996 (GenBank accession: MN403533) actttatattttatttttggagcttgagctggaatagtaggtacttccttaagaatc ataattcgtgctgaattaggacacccaggagcacttattggtgatgaccaaatttat aatgtgattgttactgcacatgcttttattataattttttttatagtaatacctattataa taggaggttttggtaattgacttgtacctttaatattaggagccccagatatggcatt ccctcgaatgaataatataagtttttgaatattacctccttctttaactcttttattagc cagaagtatagtagaaaatggagctggaactggttgaacagtttatcctcctttatc ttctagaatcgctcatagtggagcttctgttgatttagcaattttctctcttcatttag ctggaatttcatctattttaggagctgtaaattttattacaacaattattaatatacga tcatcaggtattacatttgaccgaatacctctatttgtttgatctgtaggtattacag ctttattgctactcttatcacttcctgttttagctggtgctattacaatactattaaca gaccgaaattttaatacttcattttttgacccagcaggaggaggagatccaatttta taccaacatttattc. Diagnosis Well characterized by the following combination of characters: with unique semi-circular expansion with modified peg-like setae on the forefemur (Fig. 5b), hind tibia strongly constricted (Fig. 5d, e), and abdomen narrow and elongate. Three haplotypes were examined; variations in setation were observed between the main cluster and two haplotypes (Figs. 6 and 7). Only single specimens of the two distinct haplotypes were available; more specimens would be necessary to determine if these are eventually recognized as distinct species or fall within a continuum of intraspecific variation. Material examined Holotype. ♂, UGANDA: Kamwenge, Kibale National Park (00° 33 ′ 54.2 ″ N 30° 21 ′ 31.3 ″ E, 1530 m), iiixii.2010, Olavi Kurina & Swaibu Katusabe (LKCNHM UGC0005996). Paratypes. 7 ♂, UGANDA: Kamwenge, Kibale National Park (00° 33 ′ 54.2 ″ N 30° 21 ′ 31.3 ″ E, 1530 m), iii-xii.2010, Olavi Kurina & Swaibu Katusabe (LKCNHM: UGC0012899, UGC0012244, UGC0012568, UGC0003003, UGC0005864, UGC0012937, UGC0012971). Distribution Known from a single site in Kibale National Park, Uganda. Biology Unknown. Etymology Name suggested by Yuchen Ang for the sepsid-like (Diptera: Sepsidae) foreleg modification.Published as part of Srivathsan, Amrita, Hartop, Emily, Puniamoorthy, Jayanthi, Lee, Wan Ting, Kutty, Sujatha Narayanan, Kurina, Olavi & Meier, Rudolf, 2019, Rapid, large-scale species discovery in hyperdiverse taxa using 1 D MinION sequencing, pp. 1-20 in BMC Biology 17 on page 10, DOI: 10.1186/s12915-019-0706-9, http://zenodo.org/record/371085
KONSELING INDIVIDU DALAM MENGATASI SISWA TEMPERAMENTAL (Studi Kasus pada Satu Siswa Kelas IX SMP Negeri 15 Yogyakarta)
No full textDEA ANGELITA PUTRI JAYANTHI, 15220025, Konseling Individu dalam Mengatasi Siswa Temperamental di SMP Negeri 15 Yogyakarta. Skripsi, Program Studi Bimbingan Konseling Islam, Fakultas Dakwah dan Komunikasi UIN Sunan Kalijaga Yogyakarta, 2019.
Latar belakang penelitian ini adalah karena setiap siswa memiliki emosi yang berbeda-beda dalam menghadapi persoalan dikehidupan sehari-hari. Emosi dibagi menjadi dua, dilihat dari dampak yang ditimbulkannya, yaitu emosi negatif dan emosi positif. Salah satu emosi negatif yaitu marah. Temperamental adalah gaya perilaku dan cara khas pemberian respon seseorang. Sikap temperamental tersebut mempengaruhi dan memberikan dampak dalam keseharian siswa. Bahkan mendapat labeling dari guru.
Tujuan penelitian ini adalah untuk mengetahui langkah-langkah pelaksanaan konseling individu yang digunakan dalam mengatasi siswa temperamental di SMP N 15 Yogyakarta. Dengan konseling individu mampu mengatasi siswa yang memiliki sikap temperamental dengan memberikan arahan, solusi, nasihat dan treatment.
Jenis penelitian ini adalah penelitian lapangan, dengan metode pengumpulan data observasi, wawancara, dan dokumentasi. Analisis data yang digunakan adalah analisa deskriptif kualitatif dengan memberikan pemaparan mengenai situasi yang diteliti dalam bentuk uraian narasi hasil penelitian. Subyek penelitian adalah Guru BK, wali kelas, dan satu siswa yaitu GR.
Hasil penelitian menunjukkan bahwa langkah-langkah konseling individu dalam mengatasi siswa temperamental yaitu identifikasi masalah, himpunan data, diagnosis, prognosis, pemberian treatment, monitoring dan tindak lanjut
Relationship between restrained eating behavior and dietary calcium intake among female adolescents
No full textThe purpose of this study was to determine the effect of restrained eating behavior on dietary calcium intake in adolescents. Research shows that female adolescents have lower calcium intake then males. Research also suggests that dieting has a negative impact on the dietary intake of several nutrients, including calcium.A random sample of adolescents from physical education and health classes at Muncie Central High School, a mid-western urban public school, participated in this study. Subjects completed one 24 hour food record, a modified three-factor eating questionnaire to assess dietary restraint, and demographic sheet.Of the 85 subjects (females n=60; males n=25) who participated in the study, 65% (n=56) did not meet the dietary calcium recommendations of 1300 mg/day. Among females, 75% (n=45) did not meet calcium recommendations. For males, 44% (n=11) did not meet the daily calcium recommendations. Mean calcium intake for females and males respectively was 1121 ± 939 mg/day and 1632 ±1242 mg/day.Seventy-five percent of all subjects had low to average dietary restraint. A greater percentage of females (17%, n=10; 15%, n=9) than males (4%, n=1; 4%, n=1) were found to have high and clinical levels of dietary restraint. Interestingly, the mean calcium intake for those males and females having clinical levels of dietary restraint did meet calcium recommendations (1403 mg/day and 1341 ± 829 mg/day). For females, the mean calcium intake for both low to average and high dietary restraint did not meet calcium requirements. For males, mean calcium intake among all levels of restraint met the recommendations.Thesis (M.S.)Department of Family and Consumer Science
The Baltic challenge and Euro-area entry. Bruegel Policy Contribution 2009/13, November 2009
No full textResident Fellow Zsolt Darvas takes a look at the issue of the Baltic states - Estonia, Latvia and Lithuania - and the challenges facing those three countries in the aftermath of the financial crisis. He argues that because it is in the broader European interest to prevent a collapse in the Baltics, the best option is immediate euro entry at a suitable exchange rate supported by appropriate resolution in order to manage the resulting debt overhang. However, there seems to be no legal basis for this under the current euro accession criteria. Furthermore, the economic foundations of the criteria are fundamentally flawed, as euro-area members continue to violate the criteria while the EU's expansion to 27 members has made the criteria tougher for new member states to meet themselves. Ultimately, the European Council has the ability to reform the criteria without a formal treaty change. The Council should do so, the author argues, and allow for more meaningful benchmarks for all future euro-area applicants
The prevalence of fad diets on a college campus : an honors thesis (HONRS 499)
No full textThe Prevalence of Fad Diets on a College Campus StudentThe purpose of this study was to assess the presence of fad dieting, as well as evaluate the results of such fad diets, among male and female students at Ball State University. In this project, 336 students completed a 24-question survey. Forty-seven subjects were eliminated due to age restrictions. The study limitations required subjects to be between the ages of 18-23. The average age for the study was 20 years ± 1.39 years. Of the 289 subjects used, 76 (26%) were males and 213 (74%) were females. One-third (n=93) of the students surveyed said they had tried a fad diet. Of that percentage, 13% (n=10) of the males had tried a fad diet, and 40% (n=83) of the females had tried a fad diet. The results of the longest fad diet tried by students were primarily weight gain or no change in weight. Forty-three percent (n=37) of those who tried a fad diet said they gained weight, while 37% (n=32) said they experienced no change at all. Not surprisingly, 58.1 % (n=54) of fad dieters only stayed on the diet for one month or less. Also, 34.4% (n=32) of the fad dieters stayed on the diet for three months or less. Therefore, the survey results showed that a combined 92.5% of the fad dieters were not able to sustain their fad diet of choice for long. Overall, those students who tried a fad diet expressed a dissatisfaction with the results. Forty-six percent (n=34) said fad diets are unhealthy and fail to produce lasting results, while another 14.9% (n=11) viewed such diets as unhealthy. The investigator of this study believes that college students are no exception to today's trend of fad dieting. However, this study reflects the failure of such fad diets as a permanent weight loss plan for students.Thesis (B.S.)Honors Colleg
- …
