Indonesian Journal of Biotechnology
Not a member yet
387 research outputs found
Sort by
Developmental Competence of Early Stage Porcine Embryos Cultured in Medium with Different Energy Substrate in vitro
No full textTo elucidate the effect of energy requirement during the early embryonic development on their developmental ability to develop to blastocyst stage, in vitro fertilized (IVF) porcine one-cell embryos were cultured in modified North Carolina State University (NCSU)-37 supplemented with different energy substrate. Result indicated that the cleavage rate of embryos in Pyr-Lac and Gluc-Pyr-Lact groups was significantly higher than in those in Gluc group and Gluc-Rib group (P < 0.05). At Day 6 of culture, the highest proportion of embryos develop to the blastocyst stage was obtained in the presence of pyruvate-lactate only. In the medium with glucose, the addition of pyruvate-lactate or ribose slightly increased the proportion of embryos develop to the blastocyst stage, however the value were not significantly different form those obtained in the presence of glucose only. The mean cell number in blastocysts derived from Pyr-Lac and Gluc-Pyr-Lact groups were significantly higher than those in the Gluc group (P < 0.05). These results indicated that the presence of glucose only, as energy substrate, during the first 2 days of in vitro culture (IVC) caused a decrease in development of in vitro produced (IVP) porcine embryos to the blastocyst stage and mean cell number in blastocysts
Molecular Study on The Pathogenicity of Avian Influenza Virus
No full textHighly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny
Effect of Probiotic Lactobacillus sp. Dad13 on Humoral Immune Response of Balb/C Mice Infected with Salmonella typhimurium
No full textAn indigenous strain of lactic acid bacterium (LAB) identified as Lactobacillus spp. Dad13 (Dad13), isolated from traditional fermented buffalo milk, was found to be potential as probiotic. The aim of this research was to study the effect of probiotic Dad13 on humoral immune response of Balb/C mice infected with Salmonella typhimurium. The specific objective was to find out the effect of different Dad13 consumption time (before and along with infection of S. typhimurium) on the humoral immune response of Balb/C mice. The experiment was conducted by in vivo trial on 20 males of Balb/C mice, age of 6-8 weeks, fed with AIN-93 standard diet. The mice were assigned into 4 groups. Each group received the following treatments, ie. Dad13 only, Dad13 before infection, Dad13 along with infection and Salmonella infection only. A volume of 100 µl Dad13 cell suspensions (1010 CFU/ml) were given by oral forced feeding daily for a week, at week 3 for group before infection and at week 4 for group of Dad13 only and Dad13 along with infection. Salmonella infection (109 CFU/ml) was given once orally at week 4 to all groups except group treated with Dad13 only. The humoral immune response of Balb/C mice was detected 2 weeks after infection by measuring the titers of IgG and IgA specific from serum and mucosal intestinal liquid samples using Enzyme-linked Immunosorbent Assay (ELISA) method. The result indicated that humoral immune response of Balb/C mice consuming Dad13 before and along with Salmonella infection were significantly different (p<0.05). Dad13 consumption along with Salmonella infection increased circulated IgG and IgA as well as secretory IgA. It can be concluded that Dad13 probiotic feeding along with infection increased humoral immune response more significantly compared to that before infection
Production and Extraction Of Antibacterial Bacteriocin from Pediococcus sp. NWD 015
No full textobjectives were to study the growth pattern of Pediococcus sp. NWD 015 and bacteriocin activity, extractionand characterization of bacteriocin, and to determine the effect of storage time and temperature on bacteriocinactivity. Results showed that the bacteriocin activity increased during growth and reached the highest activity duringstationary phase. The maximum bacteriocin production reached after incubation of the cell for 12 h at 37oC in TGEbroth and decreased after 96 h incubation. Extraction with adsorbtion-desorbtion method could increased a specificactivity of bacteriocin. Bacteriocin from Pediococcus sp. NWD 015 is inactivated by Proteinase-K; however it is stillactive by heat treatment at 121oC for 15 min and over pH 2 – 11. Bacteriocin of Pediococcus sp. NWD 015 was effectiveagaints Enterococcus faecalis, Staphylococcus aureus, Eschericia coli, Listeria monocytogenes but not against Salmonellathypimurium. The molecular weight of bacteriocin is 4.95 kDa.Keywords : Bacteriocins, Pediococcus sp NWD 015
Apoptosis and Phagocytosis Activity of Macrophages Infected by Mycobacterium tuberculosis Resistant and Sensitive Isoniazid Clinical Isolates
No full textMycobacterium tuberculosis (M.tb) is the main causative pathogen that cause the pulmonary tuberculosis.Intracellular M.tb was reported able to induce macrophages apoptosis, which may have crucial role in the regulationof immun response against M.tb infection. As an intracellular bacteria, M.tb able to live and replicate withinmacrophages. Phagocytosis is the first step to achieved this condition. The induction of macrophages apoptosis byINH resistant and sensitive M.tb clinical isolates, and H37Rv was studied. The macrophages apoptosis level weremeasured using an Ag-capture ELISA for histone and fragmented DNA (Cell Death Detection ELISAplus, RocheDiagnostic GmBH). Phagocytosis activity also analyzed, after staining using fluorescence dye (AcriFluorTM, ScientificDevice Lab.). The results showed that there was no significantly different between INH resistant and sensitive M.tbclinical isolates in respect their ability to induce apoptosis. The phagocytosis activity among the clinical isolates wasshown to be strain dependent, and undistinguishable between the Mtb clinical isolates. There was no associationbetween macrophages apoptosis level and the phagocytosis activity. These data suggested that among the virulentMtb clinical isolates, the ability to induce macrophages apoptosis and phagocytosis were consistently in comparablelevelKeywords: Mycobacterium tuberculosis, apoptosis, phagocytosis, macrophages, isoniazi
Mineral Phosphate Solubilizing Bacteria Isolated from Various Plant Rhizosphere under Different Aluminum Content
No full textThe objectives of this study was to isolate and characterize the mineral phosphate solubilizing bacteria from rhizosphere and evaluate their potential as plant growth promoting bacteria in Al-toxic soils. The halo zone formation method was used to isolate PSB using the media containing insoluble phosphates (Ca-P or Al-P) as a source of phosphate. Eight of acid and Al-tolerant PSB isolates that were able to solubilize Ca-P were obtained from rhizosphere of clover, wheat, corn, and sunflower grown in Al-toxic soil. Identification of the isolates based on the 16S rRNA gene sequence analysis demonstrated that the isolates were strains of Burkholderia (5 strains), Pseudomonas (1 strain), Ralstonia (1 strain), and unidentified bacterium (1 strains). All PSB isolates showed the capability to dissolve Ca-P, and only 1 strain (Ralstonia strain) was able to dissolve Al-P in agar plate medium. The P-solubilization by these isolates was correlated with pH of medium. Inoculation of the bacterial strains on clover on Al-toxic medium showed that all isolates increased the plant dry weight compared with uninoculated treatment. Our results showed that those PSB isolates have potential to be developed as a biofertilizer to increase the efficiency of P-inorganic fertilizer used in Al-toxic soils
Distribution of Camphor Monooxygenase Genes in Soil Bacteria
No full textIn microbial degradation of camphor, the first step is oxidation by multiunit enzyme, camphor monooxygenase, encoded by cam genes (camA,B,C). Seven camphor-utilizing bacterial strains have been isolated from soil at various locations. CamA,B,C genes of Pseudomonas putida strain PpG1 and strain GF2001 were used as probes to explore their abundance in the camphor-utilizing bacteria. Southern analysis revealed that all of the cam genes of GF2001 could hybridize well to the SpeI-digested genomic DNA of strains tested, whereas PpG1 cam genes were not. This result suggested that the GF2001 type cam genes are widely distributed among the camphor- utilizing strains in the environment. Thus strain GF2001 and seven newly isolated strains share a common evolutionary origin
Relationship between Nucleus Swelling and Development Competence of Bovine Cloned Embryos Reconstructed by Enucleated Oocytes with Serum-starved or Serum-fed Fetal Somatic Cells
No full textThis study was conducted to examine the occurrence of nuclear remodeling (nucleus swelling) and its effects on the subsequent in vitro development of bovine embryos reconstructed by serum-starved and serum-fed somatic cells. Results from this study demonstrated that all of the reconstructed embryos that received serum-starved and serum-fed somatic cells exhibited condensed-nuclei. More than 90% of the transferred nuclei exhibited nuclear envelope breakdown and premature chromatin condensation which clearly distinct from an intact nucleus. There was no significant difference on the degree of nucleus swelling in SS-NT embryos or SF-NT embryos, indicating that either serum-starved or confluent somatic cell lines could be reprogrammed by the recipient cytoplasm environments in similar pattern. Although the fusion rate was not significantly different among the groups, the proportion of SS-NT embryos which developed to the 2- to 4-cell stage (89.7%) and to the 8- to 16-cell stage (74.7%) was significantly higher than that of SF-NT embryos. Whereas, the proportion of reconstructed embryos that developed to the morula and blastocyst stages were not significantly different among the groups. Results of these studies demonstrate that reconstructed embryos, which received either serum-starved or serum-fed confluent somatic cells, showed similar developmental competence to the blastocyst stage
Cloning of cDNA Encoding GRA1 Protein of Tachyzoite Toxoplasma Gondii Local Isolate
No full textGene encoding GRA1 protein is potent DNA-vaccine candidate against toxoplasmosis. The aim of the research was to clone the gene encoding GRA1 protein of tachyzoite Toxoplasma gondii local isolate by DNA recombinant technology. Tachyzoite was grown in Balb/c mice in vivo. Messenger RNA was isolated from total RNA and it was used to synthesis cDNA. Complementary DNA encoding GRA1 protein of tachyzoite Toxoplasma gondii local isolate was amplified and cloned in a prokaryote cloning vector. The recombinant GRA1-encoding gene was then digesting using EcoRI restriction endonuclease and sequencing. The result showed that the recombinant GRA1- encoding gene consisted of DNA sequences encoding all signal peptide and mature peptide of GRA1 protein. Alignment of recombinant GRA1 sequence to gene encoding GRA1 protein of Toxoplasma gondii RH isolate showed 100% homologous
Expression Analysis and Nuclear Import Study of Full-length Isoforms Importin α as 6x Histidin-tagged Fusion Protein on the Intracellular Localization of Recombinant HBV Core Protein
No full textIsoform importin α molecules play a central role in the classical nuclear import pathway, that occurs through the nuclear pore complex (NPC) and typically requires a specific nuclear localization signal (NLS). In this study, it was investigated the role of isoforms importin α in the nuclear import of wild type recombinant hepatitis B virus core protein (WT rHBc), phosphorylated recombinant HBV core (rHBc) and recombinant HBV core without NLS by co-immunoprecipitation. Four recombinant full-length isoforms importin α as 6x histidin-tagged fusion protein were expressed and analysed from expression plasmid vectors Rch1, pHM 1969, pHM 1967 and pHM 1965. The results indicated that importin α-1, importin α-3, importin α-4 and importin α-5 can be expressed and isolated from E. coli transformed recombinant DNA plasmid as protein in size around 58-60 kDa. By the nuclear transport study shown that isoforms importin α are involved in the nuclear import of WT rHBc, phosphorylated rHBc and rHBc without NLS. It also indicated that they have an important role for nuclear transport of from cytoplasm into the nucleus