Indonesian Journal of Biotechnology
Not a member yet
387 research outputs found
Sort by
Cloning and Sequencing cDNA Encoding for Rhoptry-2 Toxoplasma Gondii Tachyzoite Local Isolate
Rhoptry protein belongs to an excretory and secretory antigens (ESAs) that play an important role during active penetration of parasite into the cell target. This protein an able Toxoplasma gondii to actively penetrate targeted cell, meanwhile ESAs protein stimulates intracellular vacuole modification. It is, therefore, after the parasite successfully enter the cell target then Granule (GRA) proteins are responsible for the formation of parasitophorus vacuole, which is protect the fusion with other intracellular compartments such as lysosomal vacuole. Consequently, this parasite is being able to survive and multiply at the cell target. The current study was aimed to clone and sequens cDNA encoding for ROP-2 of local isolated T. gondii tachizoite through DNA recombinant technique. Total ribonucleic acid (RNA) was isolated from tachyzoites of local isolated T. gondii that were grown up in Balb/ c mice. Messenger RNA was isolated from total RNA using PolyAtract mRNA Isolation System. Messenger RNA was used as a template for synthesis cDNA using Riboclone cDNA Synthesis System AMV-RT. EcoRI adaptor from Riboclone EcoRI Adaptor Ligation System was added to Complementary DNA and than ligated to pUC19. Recombinant plasmid was transformed into E. coli (XL1-Blue). The transformed E. coli XL-1 Blue were plated on LB agar containing X-Gal, IPTG and ampicillin. Recombinant clones (white colony) were picked up and grown up in the LB medium at 37oC overnight. Expression of recombinant protein was analysed by immunoblotting in order to identify cDNA recombinant wich is express ESA of T. gondii local isolate. Recombinant plasmid were isolated using alkalilysis method and were elektroforated in 1% agarose gel. The isolated DNA recombinant plasmid was cut using Eco RI and then sequenced through Big Dye Terminator Mix AB1 377A Sequencer using M13 Forward and M13 Reverse primers. The conclusion of this results showed that the recombinant clone was coding for excretory and secretory protein which has molecular weight of 54 kDa. The DNA alignments of sequence from the cloned gene showed 97% homology with gene encoding for ROP-2 of T. gondii RH isolate
Nuclear Import Analysis of Two Different Fluorescent Marker Proteins into Hepatocyte Cell Lines (HuH-7 Cell)
The application of fluorescent proteins as expression markers and protein fusion partners has proved immensely valuable for resolving the organization of biological events in living cells. EGFP and DsRed2 are commonly fluorescent marker protein which is used for biotechnology and cell biology research. The present study was designed to identify the expression vector that suitable to ligate with DNA encoding HBV core protein for intracellular localization study in hepatocyte cell, which were expressed as fusion proteins. We also compared and quantified the expressed fluorescent protein which predominantly localized in the cell compartment. The results indicated that DsRed2 shown as less than ideal for intracellular localization study of than EGFP, because of its tetrameric structure of the fluorescent protein and when fused to a protein of interest, the fusion protein often forms aggregates in the living cells. In contrast, EGFP fluorescent protein shown a much higher proportion of cytoplasmic localization, thus being more suitable for analysis of intracellular localization than DsRed2 fluorescent protein. EGFP fluorescent protein is also capable to produce a strong green fluorescence when excited by blue light, without any exogenously added substrate or cofactor, events inside living cell can thus be visualized in a non-invasive way. Based on our present quantitative data and some reasons above shown that EGFP is more suitable than DsRed2 as a fluorescent marker protein for intracellular localization study into HuH-7 cell
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus
The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesia was determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of the RC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomain between this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effective for rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the G genes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus from China than to viruses from Thailand and Malaysia. This genetic data and historical background suggest that rabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from China to Indonesia
A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis
oai:journal.ugm.ac.id:article/7409The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/µl, 52,25 pg/µl, 15,83 pg/µl and 5,225 pg/µl were tested to detect 0,6551 µg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/µl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method
Analysis of Htra Gene from Zebrafish (Danio Rerio)
HtrA which is characterized by the combination of a trypsin-like catalytic domain with at least one C-terminal PDZ domain is a highly conserved family of serine proteases found in a wide range of organisms. However the identified HtrA family numbers varies among spesies, for example the number of mammalian, Eschericia coli, fruit fly-HtrA family are 4, 3 and 1 gene respectively. One gene is predicted exist in zebrafish. Since no complete information available on zebrafish HtrA, in this paper zebrafish HtrA (zHtrA) gene was analyzed. The zHtrA is belonged to HtrA1 member and predicted encodes 478 amino acids with a signal peptide, a IGF binding domain, a Kazal-type inhibitor domain in the up stream of HtrA-bacterial homolog. At the amino acid sequence the zHtrA1 showed the 69%, 69%, 68%, 54% and 54% with the rat HtrA1, mouse HtrA1, human HtrA1, human HtrA3 and mouse HtrA4 respectively. The zHtrA1 is firstly expressed at 60 hpf and mainly in the vertebral rudiments in the tail region
Development of Intergeneric Canine Embryo Using Bovine and Porcine Oocyte as Cytoplasm Recipient
This study was conducted to increase the efficiency of canine embryo production by intergeneric somatic cell nuclear transfer (SCNT) technology. The effect of oocyte recipient for development of intergeneric canine somatic cell cloning embryos were examined. Bovine and porcine cumulus oocyte complexes (COCs) were collected from slaughterhouse ovaries and matured in TCM-199 medium depend on species. Adult dog fibroblasts collected from 3.5 years old Afghanhound dog, and cell between passage 1 and passage 10 used for intergeneric somatic cell cloning using bovine and porcine oocytes as oocyte cytoplasm donor. The result showed that oocytes from bovine and porcine can de-differentiated canine nucleus and no different between bovine and porcine oocyte in fusion and embryo development in vitro. Canine intergeneric cloned embryos developed to morula stages in vitro
Cloning Gene Encoding Micronema 3 (Mic3) Protein of Tachyzoite Toxoplasma Gondii Local Isolate
Microneme 3 (MIC3) protein tachyzoites Toxoplasma gondii is one of protein which plays an important role during cell host invasion. Gene encoding MIC3 protein has been studied and it was suggested a potent vaccine candidate against Toxoplasma gondii infection. The aim of this research is to clone and sequence the gene encoding MIC3 protein of tachyzoites Toxoplasma gondii local isolate by amplification using polymerase chain reaction with specific primers. The amplified DNA fragment was cloned into pGEM-T and transformed into E. coli XL-1 Blue by heat shock method. Recombinant plasmids were isolated using alkali lysis method and analyzed by digestion using restriction endonuclease enzymes PstI, HindIII, NcoI and EcoRV. The recombinant plasmids then sequenced to find out the nucleotide sequence of insert gene by ABIPRISM 377 DNA Sequencer. The DNA sequence then were analyzed by computer software for alignment. The result showed that transformation in E. coli XL-1 Blue by pGEM-T produced one clone that was encoding MIC3 protein. Analysis of 489 bp from 5’ and 447 from 3’ of gene sequence showed 97-98% homology with gene encoding for MIC3 protein of RH isolate