BioWallacea Journal of Biological Research
Not a member yet
    47 research outputs found

    Pemetaan Distribusi Regenarasi Alami Semai Berdasarkan Jenis Tegakan Mangrove Di Kawasan Teluk Kendari

    Get PDF
    Regenerasi semai pada hutan mangrove merupakan salah satu bagian penting dalam proses suksesi sekunder. Inventarisasi seedling yang tumbuh secara alami di berbagai tegakan mangrove, berkepentingan sangat kuat meningkatkan keberhasilan restorasi ekosistem mangrove di Teluk Kendari yang mengalami berbagai tekanan lingkungan fisik secara terus- menerus. Penelitian ini bertujuan menganalisis dan memetakan bagaimana distribusi regenerasi alami semai berdasarkan jenis tegakan mangrove di Teluk Kendari. Jenis penelitian kuantitatif dengan metode survei, dan inventarisasi vegetasi dilakukan dengan membuat belt transect, identifikasi jenis dan komposisi, kemudian diterjemahkan dalam bentuk peta spasial dengan memanfaatkan analisis Sistem Informasi Geografis (SIG). Hasil penelitian menunjukkan tegakan mangrove di Kawasan Teluk Kendari didominasi oleh jenis tegakan campuran atau bergerombol (66,64%), jenis tegakan Sonneratia alba (22,12%), dan tegakan Rhizophora mucronata (11,24%) dan terdistribusi 9 spesies regenerasi alami semai. Distribusi spasial menunjukkan pada tegakan bergerombol didominasi oleh jenis semai A. marina (Forssk.) Vierh. dengan KR 23,78% dan FR 21,86%, kemudian X. granatum J. Koenig. KR 14,01 dan FR 15,61%, jenis B. gymnorrhiza (L) Lamk. KR 14,66% dan FR 12,49%, jenis S. alba Grifft. KR 12,70% dan FR 10,93%, serta jenis R. apiculata Bl. dengan KR 7,82% dan FR 12,49%. Pada tegakan S. alba Grifft. distribusi semai didominasi oleh jenis S. alba Grifft. itu sendiri mencapai nilai KR 44,08% dan FR 26,44% disusul oleh jenis mucronata Lamk. dengan KR 20,39% dan FR 37,52%. Sebaliknya pada tegakan R. mucronata Lamk. juga memperlihatkan dominasi jenis semai R. mucronata Lamk. itu sendiri dengan nilai KR 58,66% dan FR 31,25% dan disusul oleh semai B. gymnorrhiza (L) Lamk. dengan nilai KR 13,78% dan FR 20,83%. Importance value index atau INP diperlihatkan oleh jenis R. mucronata Lamk. mencapai 45,49%, kemudian S. alba Grifft. 37,33%, B. gymnorrhiza (L) Lamk. 31,49%, A. marina (Forssk.) Vierh. 25,06%, dan R. apiculata Bl. 23,41% memiliki tingkat penguasaan tertinggi dalam komunitas serta peranannya dalam stabilitas ekosistem mangrove berkelanjutan di Kawasan Teluk Kendari. Pemetaan distribusi spasial regenerasi alami semai menjadi informasi penting mendukung restorasi ekosistem mangrove terdegradasi melalui dukungan kebijakan pengendalian secara ketat kawasan permukiman dan kegiatan lainnya yang tumbuh secara tidak terencana, pengendalian marine debris dan peningkatan kelembagaan masyarakat, perencanaan rehabilitasi ekosistem mangrove secara tepat, pelibatan akademisi atau pakar, serta mempertimbangkan penggunaan bibit atau seedling yang sesuai dengan karakteristik habitat mangrove pada program penanaman yang dilakukan oleh instansi pemerintah dan non pemerintah setiap tahunnya.   Kata Kunci: Distribusi Regenerasi Alami Semai, Tegakan Mangrove, SIG, Rekomendasi Pengelolaan Berkelanjutan, Teluk Kendari. Abstract Seedling regeneration in mangrove forests is an important part of the secondary succession process. Inventory of seedlings that grow naturally in various mangrove stands is very important to increase the success of mangrove ecosystem restoration in Kendari Bay which experiences various physical environmental pressures continuously. This study aims to analyze and map how the distribution of natural regeneration of seedlings is based on the type of mangrove stands in Kendari Bay. The type of quantitative research with survey methods, and vegetation inventory was carried out by making belt transects, identifying types and compositions, then translated into spatial maps using Geographic Information System (GIS) analysis. The results showed that mangrove stands in the Kendari Bay area were dominated by mixed stand types (66,64%), Sonneratia alba stand types (22,12%), and Rhizophora mucronata stands (11,24%) and were distributed by 9 species of natural regeneration of seedlings. Spatial distribution shows that mixed or clustered stands are dominated by the A. marina (Forssk.) Vierh seedling type with KR 23,78% and FR 2,86%, then X. granatum J. Koenig. KR 14,01 and FR 15,61%, B. gymnorrhiza (L) Lamk. KR 14,66% and FR 12,49%, S. alba Grifft. KR 12,70% and FR 10,93%, and R. apiculata Bl. with KR 7,82% and FR 12,49%. In the S. alba Grifft. stand, the distribution of seedlings was dominated by the S. alba Grifft. species itself reaching a KR value of 44,08% and FR 26,44% followed by the R. mucronata Lamk. species with KR 20,39% and FR 37,52%. On the other hand, in the R. mucronata Lamk. stand, the distribution of seedlings was dominated by the S. alba Grifft. species itself reaching a KR value of 44,08% and FR 26,44% followed by the R. mucronata Lamk. species with KR 20,39% and FR 37,52%. In contrast, in the R. mucronata Lamk. stand, the distribution of seedlings was dominated by the S. alba Grifft. species itself reaching a KR value of 44,08% and FR 26,44% followed by the R. mucronata Lamk. species with KR 20,39% and FR 37,52%. also shows the dominance of the R. mucronata Lamk. seedling type itself with a KR value of 58,66% and FR of 31,25% and followed by B. gymnorrhiza (L) Lamk. seedlings with a KR value of 13,78% and FR of 20,83%. The Importance Value Index or INP is shown by the R. mucronata Lamk. type reaching 45,49%, then S. alba Grifft. 37,33%, B. gymnorrhiza (L) Lamk. 31,49%, A. marina (Forssk.) Vierh. 25,06%, and R. apiculata Bl. 23,41% have the highest level of mastery in the community and their role in the stability of sustainable mangrove ecosystems in the Kendari Bay Area. Mapping the spatial distribution of natural regeneration of seedlings is important information to support the restoration of degraded mangrove ecosystems through the support of strict control policies for residential areas and other activities that grow unplanned, control of marine debris and improvement of community institutions, appropriate planning for mangrove ecosystem rehabilitation, involvement of academics or experts, and considering the use of seeds or seedlings that are in accordance with the characteristics of mangrove habitats in planting programs carried out by government and non-government agencies every year. Keywords: Natural Regeneration Distribution of Seedlings, Mangrove Stand, GIS, Sustainable Management Recommendations, Kendari Bay

    Aktivitas Antiinflamasi Ekstrak Buah Libo (Ficus septica burm. f) Serta Korelasinya Dengan Total Flavonoid

    Get PDF
    Inflamasi merupakan kondisi normal pada tubuh untuk perlindungan dan peningkatan proses penyembuhan jaringan tubuh yang terluka. Tujuan dari penelitian ini adalah untuk mengevaluasi potensi buah libo (Ficus septica Burm. F) sebagai sumber antiinflamasi. Aktivitas antiinflamasi, kadar fenolik dan flavonoid total, korelasi kadar fenolik dan flavonoid total terhadap aktivitas antiinflamasi, serta pengelompokan berdasarkan spektrum FTIR dianalisis pada ekstrak metanol dan terpurifikasi dari empat lokasi: Parigi, Kendari Barat, Sampara, dan Katobu. Aktivitas antiinflamasi diuji dengan metode penghambatan denaturasi protein dan stabilitas membran sel darah merah, kadar fenolik total dengan metode Folin-Ciocalteau, dan kadar flavonoid total dengan metode kolorimetri aluminium klorida. Spektrum FTIR digunakan untuk pengelompokan sampel. Hasil uji aktivitas antiinflamasi dengan metode denaturasi protein pada ekstrak metanol dan ekstrak metanol terpurifikasi menunjukkan aktivitas antiinflamasi yang sangat kuat dengan nilai IC50< 50 ppm, dan pada metode stabilisasi membran sel darah merah pada ekstrak metanol dan ekstrak terpurifikasi menunjukkan aktivitas antinflamasi kuat dengan nilai IC50 50-100 ppm. Kadar fenolik dan kadar flavonoid total dari ekstrak terpurifikasi lebih tinggi dibandingkan ekstrak metanol. Korelasi antara aktivitas antiinflamasi dengan kadar fenolik dan flavonoid total adalah korelasi negatif yang ditunjukkan dari sudut yang terbentuk lebih dari 90°. Berdasarkan spektra FTIR, ekstrak metanol dan ekstrak terpurifikasi dari empat lokasi terbentuk menjadi tiga kelompok. Ekstrak metanol dan ekstrak terpurifikasi buah libo berpotensi sebagai antiinflamasi

    Efek Antifertilitas Ekstrak Batang Brotowali (Tinospora crispa L.) Terhadap Kualitas Spermatozoa Mencit (Mus musculus L.) dalam Upaya Pengendalian Hama Rodentia

    Get PDF
    This study aims to determine the antifertility effect of Tinospora crispa L. stem extract on spermatozoa quality in the form of motility and morphology of mouse spermatozoa (Mus musculus L.). 20 male mice weighing 30-40 grams, aged 2-3 months, were divided into 5 treatments, namely; control (K1), placebo Na CMC 0.5% (K2), concentration of 0.05 g/g BW (K3), concentration of 0.06 g/g BW (K4), and concentration of 0.07 g/g BW (K5) Tinospora crispa L. stem extract. The extract was given orally every day for 34 days. On the 35th day, the body weight of the mice was weighed, and then sacrificed by anesthetizing with 10% chloroform, then dissected and the cauda epididymis was taken to observe the motility and morphology of mouse spermatozoa. Data were analyzed by ANOVA and BNT follow-up test (α = 0.05). The results showed that the administration of brotowali stem extract significantly reduced the motility and morphology of normal spermatozoa in mice at all concentrations. The highest decrease in motility was in the K4 (60.75%) and K5 (82.75%) treatments compared to the K1 (11%) treatments. K2 (16%) and K3 (16.25%). Brotowali stem extract also significantly reduced the percentage of normal spermatozoa morphology, namely K1 (19.25%), K2 (24.75%), K3 (45%), K4 (59%) and K5 (76.75%). The conclusion of this study is that brotowali stem extract can be used to control rodent pests biologically because it has an antifertility effect, namely reducing the quality of spermatozoa. Key words: antifertility, Zingiber officinale, Mus musculus, motility, morphology, spermatozoa This study aims to determine the antifertility effect of Tinospora crispa L. stem extract on spermatozoa quality in the form of motility and morphology of mouse spermatozoa (Mus musculus L.). 20 male mice weighing 30-40 grams, aged 2-3 months, were divided into 5 treatments, namely; control (K1), placebo Na CMC 0.5% (K2), concentration of 0.05 g/g BW (K3), concentration of 0.06 g/g BW (K4), and concentration of 0.07 g/g BW (K5) Tinospora crispa L. stem extract. The extract was given orally every day for 34 days. On the 35th day, the body weight of the mice was weighed, and then sacrificed by anesthetizing with 10% chloroform, then dissected and the cauda epididymis was taken to observe the motility and morphology of mouse spermatozoa. Data were analyzed by ANOVA and BNT follow-up test (α = 0.05). The results showed that the administration of brotowali stem extract significantly reduced the motility and morphology of normal spermatozoa in mice at all concentrations. The highest decrease in motility was in the K4 (60.75%) and K5 (82.75%) treatments compared to the K1 (11%) treatments. K2 (16%) and K3 (16.25%). Brotowali stem extract also significantly reduced the percentage of normal spermatozoa morphology, namely K1 (19.25%), K2 (24.75%), K3 (45%), K4 (59%) and K5 (76.75%). The conclusion of this study is that brotowali stem extract can be used to control rodent pests biologically because it has an antifertility effect, namely reducing the quality of spermatozoa. Key words: antifertility, Zingiber officinale, Mus musculus, motility, morphology, spermatozo

    Profil Senyawa Aktif dan Aktivitas Antiimflamasi Minuman Fermentasi Lokal (Arak Beras) Asal Kalimantan Barat

    No full text
    Traditional rice wine is one of the fermented beverages that holds high cultural value in West Kalimantan, particularly among the Dayak community. Its fermentation process involves natural microorganisms found in traditional yeast (tapai yeast) such as Saccharomyces cerevisiae, Rhizopus spp., and Lactobacillus spp. This study aims to identify the active compounds present in rice wine and evaluate its biological activities, particularly its anti-inflammatory activity. The methods used include GC-MS analysis, in vitro activity testing, and in silico validation. The results revealed nine types of compounds, some of which exhibit biological activities such as anti-inflammation, and successful in silico validation of anti-inflammatory activity was conducted. Through laboratory analysis and biological activity testing, it is hoped to provide a deeper understanding of the health benefits of rice wine and its contribution to traditional medicine

    Pengaruh Tumbuhan Air Genjer (Limnocharis flava), Mata Lele (Lemna minor) dan Paku Air (Azolla pinnata) Serta Bobot Biomasa Terhadap Kualitas Air Limbah Tahu

    No full text
    Sebagian besar industri pengolahan tahu berskala rumah tangga dengan keterbatasan modal dan fasilitas, sehingga menghasilkan limbah cair yang mengandung senyawa organik dan anorganik yang meningkatkan BOD, COD, TSS, serta menurunkan kadar oksigen terlarut, yang berdampak negatif terhadap lingkungan. Fitoremediasi menggunakan tumbuhan air merupakan salah satu alternatif pengolahan limbah cair tahu. Biomassa tumbuhan air berhubungan langsung dengan kemampuannya menyerap polutan. Penelitian ini menggunakan tiga jenis tumbuhan air, yaitu genjer (Limnocharis flava), mata lele (Lemna minor), dan paku air (Azolla pinnata) dengan variasi bobot untuk mengetahui efektivitasnya dalam menurunkan kadar COD, BOD, TSS, dan amoniak pada air limbah tahu. Tujuan penelitian ini adalah: (1) mendapatkan jenis tumbuhan dan bobot terbaik dalam menurunkan parameter pencemar, dan (2) mendapatkan interaksi antara jenis tumbuhan dan bobot yang paling efektif. Penelitian menggunakan Rancangan Acak Kelompok Faktorial dengan dua faktor: jenis tumbuhan (T1–T7) dan bobot tumbuhan (0,1 kg, 0,2 kg, dan 0,3 kg), serta kontrol air bersih. Setiap perlakuan diulang tiga kali. Pengamatan dilakukan setiap minggu pada hari ke-7, 14, 21, dan 28. Hasil menunjukkan bahwa genjer (T1) dan kombinasi genjer + mata lele (T4) paling efektif menurunkan COD, BOD dan TSS, sedangkan T4 dan mata lele (T2) lebih efektif menurunkan amoniak. Bobot 0,1 kg dan 0,2 kg lebih efektif menurunkan COD, BOD, dan TSS, sedangkan bobot 0,3 kg efektif untuk amoniak

    Status Ekosistem Terumbu Karang dan Biota Predasi (Acanthaster planci) di Kepulauan Sombori, Sulawesi Tengah

    Get PDF
    Terumbu karang merupakan ekosistem tropis dengan keanekaragaman hayati tinggi, namun saat ini menghadapi berbagai tekanan, termasuk di kawasan konservasi Kepulauan Sombori, Sulawesi Tengah. Penelitian ini bertujuan untuk mengidentifikasi keanekaragaman karang keras berdasarkan bentuk pertumbuhannya (lifeform) dan menilai kondisi tutupan karang hidup. Pengamatan dilakukan pada sembilan stasiun menggunakan metode Underwater Photo Transect (UPT), dan analisis data dilakukan dengan perangkat lunak CPCE. Hasil penelitian menunjukkan bahwa persentase tutupan karang hidup berada pada kisaran 19–67,4%, dengan kondisi bervariasi dari rusak hingga sangat baik. Ditemukan 14 jenis lifeform, dengan Acropora submassive, coral encrusting, coral massive, dan coral mushroom sebagai lifeform yang dominan dan adaptif terhadap tekanan lingkungan. Karang-karang ini memiliki keunggulan struktural dan fisiologis dalam menghadapi sedimentasi serta benturan fisik. Selain faktor lingkungan dan antropogenik, keberadaan predator alami seperti Acanthaster planci juga menjadi ancaman signifikan bagi kelangsungan hidup karang, terutama jenis dari famili Acroporidae. Studi ini menekankan pentingnya perlindungan dan pemulihan ekosistem terumbu karang dari tekanan ekologis dan biologis yang terus meningkat

    SELEKSI BAKTERI PENGHASIL ANTIBIOTIK DARI RHIZOSFER MANGROVE UNTUK PENGENDALIAN VIBRIOSIS PADA UDANG WINDU

    Get PDF
    Shrimp that live in natural habitats and in farming are often exposed to vibriosis disease caused by Vibrio infection. Currently the prevention of the disease in shrimp caused by pathogenic bacteria using synthetic antibiotics and other drugs. However, the use of antibiotics and drugs that are not wise has given rise to a new problem, namely the existence of pathogenic bacterial resistance to antibiotics, residues in shrimp body and reduce consumer confidence in the quality of the product. An alternative to prevention of disease in shrimp fishery commodities in particular is the use of natural antibiotic-producing bacteria that can inhibit growth and kill pathogenic bacteria. Selection of antibiotic-producing bacteria from the mangrove rhizosphere  based on their ability to inhibit Vibrio harveyi which is bacterium of vibriosis disease-causing. Selection of antibiotic-producing bacteria from the mangrove rhizosphere was carried out based on their ability to inhibit Vibrio harveyi bacteria that cause vibriosis using the well diffusion method. Determination of inhibitory activity was carried out based on the formation of a clear zone around the well containing the test bacterial culture. A total of 12 bacteria had antibacterial activity from 32 bacteria isolated from the mangrove rhizosphere. The bacterial isolate Sn 1.1 was the bacterial isolate that had the highest antibacterial activity among the 12 bacterial isolates with an inhibition zone diameter of 18.43 mm. Thus, the isolate Sn 1.1 is a potential isolate to be used as a probiotic to control vibriosis in tiger shrimp.   Abstrak Udang yang hidup di habitat alami maupun dalam pembudidayaan sering terkena penyakit vibriosis yaitu penyakit akibat infeksi Vibrio. Saat ini penanggulangan penyakit pada udang yang disebabkan oleh bakteri patogen menggunakan antibiotik sintetik dan obat-obatan lain. Namun, penggunaan antibiotik dan obat-obatan yang tidak bijaksana telah menimbulkan masalah baru yaitu adanya resistensi bakteri patogen terhadap antibiotik, adanya residu pada tubuh udang dan mengurangi kepercayaan konsumen terhadap kualitas produk tersebut.  Salah satu alternatif penanggulangan penyakit pada komoditas perikanan khususnya udang adalah penggunaan bakteri penghasil antibiotik alami yang dapat menghambat pertumbuhan dan membunuh bakteri patogen. Seleksi bakteri penghasil antibiotik yang berasal dari rhizosfer mangrove dilakukan berdasarkan kemampuannya dalam menghambat bakteri Vibrio harveyi penyebab penyakit vibriosis dengan menggunakan metode difusi sumuran (Well diffusion method). Penentuan aktivitas penghambatan dilakukan berdasarkan terbentuknya zona jernih di sekitar sumuran yang berisi kultur bakteri uji. Sebanyak 12 bakteri memiliki kemampuan aktivitas antibakteri dari 32 bakteri yang diisolasi dari rhizosfer mangrove. Isolat bakteri Sn 1.1 merupakan isolat bakteri yang memiliki aktivitas antibakteri tertinggi diantara 12 isolat bakteri dengan diamater zona hambat sebesar 18.43 mm. Dengan demikian, isolat Sn 1.1 merupakan isolat berpotensi digunakan sebagai probiotik untuk pengendalian vibriosis pada udang windu

    Utilization of Brazilian Spinach (Alternanthera sissoo) Leaf Extract as a Burn Medicine in Mice (Mus musculus)

    Get PDF
    Burns are symptoms of trauma to the skin, face, or tissues of the body caused by heat sources, radiation sources, exposure to certain chemical compounds, and high voltage electrical sources. The treatment of burns is done by considering the extent and depth of the burn. The utilization of natural ingredients in the form of Brazilian spinach leaves (Alternanthera sissoo) is an alternative to commercial burn medicine. Brazilian spinach leaf samples were extracted using maceration method with 96% ethanol solvent. After that, the extract of brazilian spinach leaves was carried out phytochemical screening to determine the content of phytochemical compounds that succeeded through the extraction process. The results of the phytochemical screening showed that the brazilian spinach leaf extract contained phytochemical compounds including: alkaloids, flavonoids, tannins, saponins, and steroids. Before being used for treatment in the in vivo test, the ethanol extract of brazilian spinach leaves was made into an ointment preparation. The finished ointment was then added with ethanol extract of brazilian amaranth leaves with 3 variations of concentration, namely 2%, 4%, and 8% concentrations. Furthermore, in the in vivo test, 20 BALB/C mice were grouped into 5 different treatment groups. The treatment groups include: KN (Negative Control), KP (Positive Control), P1 (2% ointment treatment), P2 (4% ointment treatment), and P3 (8% ointment treatment). All mice had their dorsal hair removed and were made to experience burn conditions by attaching hot metal to their dorsal parts. After that, treatment and observation were carried out for 7 days. Parameters observed were burn scoring and burn surface area scoring. The results showed that the 7-day treatment could reduce the parameters of burn scoring and burn surface area scoring. The most optimal results were found in the Brazilian spinach leaf extract ointment treatment group with a concentration of 4%

    Desain Primer Secara in Silico untuk Amplifikasi Gen TGF- β1 dan TNF- α pada Mencit (Mus musculus) Sebagai Kandidat Primer Dalam Uji qRT-PCR

    Get PDF
    Transforming Growth Factor Beta 1 (TGF-β1) dan Tumor Necrosis Factor Alpha (TNF-α) merupakan dua gen penting yang terlibat dalam mekanisme inflamasi dan fibrosis. Penelitian ini bertujuan untuk mendesain kandidat primer spesifik bagim kedua gen tersebut pada hewan model Mencit Mus musculus secara in silico sebagai persiapan uji ekspresi gen menggunakan metode qRT-PCR. Desain primer dilakukan menggunakan software Primer3Plus, Clone Manager Professional 9 Demo, Primer Express, dan OligoAnalyzer untuk mengevaluasi parameter kualitas primer seperti melting temperature (Tm), %GC, struktur sekunder (hairpin dan dimer), serta nilai ΔG. Analisis spesifisitas dilakukan menggunakan Primer-BLAST NCBI untuk memastikan bahwa primer hanya menempel pada target genom Mus musculus. Hasil menunjukkan bahwa kandidat sekuens terbaik yakni primer TGF-β1 forward 5’ ATTCCTGGCGTTACCTTGG 3’; reverse 5’ GTGAGCGCTGAATCGAAAG 3’ dengan produk amplikon 137 bp dan primer TNF-α forward 5’ TGCTCTGTGAAGGGAATGG 3’; reverse 5’ TTGGACCCTGAGCCATAATC 3’ dengan hasil produk 146 bp. Kandidat primer memiliki panjang 19–20 nukleotida, %GC antara 50–55% dan Tm tidak lebih dari 60°c. Tidak ditemukan struktur sekunder baik hairpin atau dimer, dengan nilai ΔG > –3 kcal/mol, menandakan primer stabil. Hasil Primer-BLAST mengonfirmasi bahwa kedua pasangan primer bersifat spesifik terhadap gen target pada Mus musculus dengan nilai 100% sehingga pasangan primer ini layak sebagai kandidat primer untuk aplikasi qRT-PCR dalam studi ekspresi gen terkait inflamasi. Validasi lanjutan di laboratorium tetap diperlukan untuk melakukan reaksi qRT-PCR dengan baik

    PROFIL SENYAWA KIMIA DAN AKTIVITAS ANTIBAKTERI KOMBUCHA DAUN PANDAN WANGI (Pandanus amaryllifolius Roxb.) TERHADAP BAKTERI PENYEBAB BAU BADAN

    Get PDF
    The purpose of this study was to determine the profile of chemical content and antibacterial activity against bacteria that cause body odor Staphylococcus epidermidis from fragrant pandan leaf kombucha (Pandanus amaryllifolius Roxb.). The profile of the chemical compound was determined qualitatively using the Thin Layer Chromatography (TLC) method. Antibacterial activity was tested using the disc diffusion method. Antibacterial activity data was statistically analyzed using One-Way ANOVA with a 95% confidence level and further analyzed using the Smallest Real Difference (SRD) test. The results of the study showed that fragrant pandan leaf kombucha has a profile of flavonoid and phenolic chemical compounds. Fragrant pandan leaf kombucha with concentrations of 20%, 30%, 40%, 50% and 100% has antibacterial activity of Staphylococcus epidermidis which is included in the weak category. Keywords : Fragrant pandan leaves, Kombucha, Thin Layer Chromatography (TLC), Antibacterial   Abstrak Penelitian ini bertujuan untuk menentukan profil kandungan kimia dan aktivitas antibakteri kombucha daun pandan wangi (Pandanus amaryllifolius Roxb.) terhadap bakteri Staphylococcus epidermidis. Pengujian kandungan senyawa kimia dilakukan secara kualitatif dengan metode Kromatografi Lapis Tipis (KLT). Pengujian aktivitas antibakteri dilakukan dengan metode difusi cakram. Data hasil uji aktivitas antibakteri dianalisis secara statistik menggunakan One-Way ANOVA dengan taraf kepercayaan 95% dan dianalisis lebih lanjut menggunakan uji BNT (Beda Nyata Terkecil). Hasil penelitian menunjukkan bahwa kombucha daun pandan wangi mengandung senyawa flavonoid dan fenolik. Kombucha daun pandan wangi memiliki aktivitas antibakteri terhadap bakteri Staphylococcus epidermidis

    42

    full texts

    47

    metadata records
    Updated in last 30 days.
    BioWallacea Journal of Biological Research
    Access Repository Dashboard
    Do you manage Open Research Online? Become a CORE Member to access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard! 👇