Jurnal Biodjati
Not a member yet
    256 research outputs found

    Bacterial Contamination at Whiteleg Shrimp (Litopeanaeus vannamei) in Aquaculture

    Get PDF
    Indonesia has a very high biodiversity, which has later become one of the natural products of interest to the international community, including fishery products. One of the high-demand Indonesian fishery products is whiteleg shrimp Litopeaneus vannamei. However, safety food Exported whiteleg shrimp products must meet the criteria, including free from bacterial contamination such as Escherichia coli, Salmonella, Vibrio cholera. This study attemptted to analyze E. coli, Salmonella, V. cholerae contamination in 3 ponds in Bojo, Cilellang, and Palanro Village in District Malusetasi, Barru Regency, South Sulawesi. Two samplings for each pond were conducted in the morning were pond water and  fresh whiteleg shrimp. SNI 2728-2018 specifies the quality and safety requirements for fresh shrimp. This standard applies to whole or headless fresh shrimp handled from fresh shrimp and does not apply to fresh shrimp that has undergone further processing. Based on SNI 2728-2018, the E. coli test showed positive in Cilellang Village (sample A) with 11 MPN/g, negative in Palanro Village (sample B) and in Bojo village (sample C) with the value of <2 MPN/g. Escherichia coli test showed positive in sample D (Vannamei shrimp in Cilellang Village) and sample E (Vannamei shrimp in Palanro Village) with 2.0 MPN/g, 17 MPN/g, respectively. Only sample F (Vannamei shrimp in Bojo village ) showed a negative result. As for the Salmonella test, positive results showed in sample A, while sample B and sample C showed negative results. The Vibrio cholerae test showed negative at all samples. . This study concludes that Whiteleg shrimp from ponds in Mallusetasi District is classified as safe for consumption

    Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes

    No full text
    Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia\u27s biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida

    Habitat Preference Modeling of Prehistoric Giant Shark Megalodon During Miocene in Bentang Formation of West Java Coast

    Get PDF
    In the Miocene era about 20 million years ago, the South Coast of West Java was a sea and habitat for marine organisms including giant sharks Megalodon measuring about 18 meters long. This study aimed to model the habitat preference of the prehistoric gigantic shark Otodus megalodon population based on the fossil record. From fossil teeth, it revealed that the rock layer where the teeth found was Bentang formation from Miocene era. Many fossils of Megalodon had been unearthed from Bentang formation which is part of the South Coast of West Java. The habitat model was developed using the Sea Level Rise Inundation Tool of ArcGIS to estimate the sea depth and Megalodon’s habitat during the Miocene. The length of the teeth of O. megalodon found was ranged from 13 to 19 cm, indicating the presence of juvenile and adult O. megalodon. Based on the model, in the Miocene era, half of West Java was a sea with a depth ranging from 0 to 200 meters. At that time, it was estimated that juvenile O. megalodon occupied waters with a depth of 0-40 meters with an area of 1365 km2. Meanwhile, adult O. megalodon prefers a depth of 80-160 m and the frequency of habitat use increases at a depth of 200 m. The declining population of O. megalodon is associated with climate change and declining prey populations

    Organic Waste as Fertilizer to Increase the Number of Peanuts (Arachis hypogaea L.) Flowers

    Get PDF
    Peanut has high economic value and a significant role in food needs. the national food supply needs for peanuts to date have not been sufficient. This study aimed to determine the effect of organic waste which in this case is mushroom baglog compost and sheep manure on the flowers and pods of peanuts. The study was conducted on March-July 2018 in Subang district using the simple experimental plot method and group-randomized factorial design with two factors with each treatment done triplicate. The first factor is the baglog compost (soil without baglog compost, 90 g/plants, 120 gr/plants); the second factor is sheep manure dose (without sheep fertilizer, 90 gr/ plants, 120 gr/plants). The results showed that the application of baglog compost and sheep manure fertilizer at concentrations of 90 g and 120 g, respectively increased the number of flowers and potential pods. Moreover, Sheep manure fertilizer at a concentration of  120 g/plant, increased the dry weight of pods, seed, and 100 seeds even though was not significant

    Effect of Fermented Kangkong Seed (Ipomoea reptans Poir.) on Characteristics and Histology of Female Quail Reproductive Organs

    Get PDF
    Quail has a high reproductive ability, which can reach 3 to 4 generations a year. The quail also have high eggs productivity and capable of producing 250-300 eggs/quail/year. Egg production is closely related to the reproductive system and feed. It is necessary to know the effect of feeding fermented kangkong on the characteristics and histology of the quail reproductive organs. The increase in livestock population should be balanced with an increase in the availability of feed. Kangkong seeds waste (Ipomoea reptans Poir.) is rejected seeds from seed factories that have the potential to become alternative feed ingredients because it contains about 13.46% protein. The purpose of this study was to determine the effect of fermented kangkong seed feed (Bikafer) on the characteristics of reproductive tract organs and histology of quail oviducts because feeds affect the development of the reproductive tract and quail egg production.  This study used a completely randomized design method (CRD) with 5 treatments and 4 replications. The treatments were as follows: R0 = commercial feed, R1 = 0%  (Bikafer), R2 = 7.5% (Bikafer), R3 = 15% (Bikafer) ,R4 = 22.5% (Bikafer). Data were analyzed using one-way ANOVA with a significance level of 95% (α = 0.05) and the Kruskal-Wallis test, while histological observations were described descriptively. The results showed that there were significant differences in the characteristics of the uterus, vaginal length, and isthmus weights. The histology of the quail reproductive tract developed well and showed the tunica mucosal tissue, serous tunica, muscular tunica, goblet cells, epithelium, and tubular gland cells

    In Silico Activity Identification of Cyclo Peptide Alkaloids from Zizyphus Spina-Christi Species Against Sars-Cov-2 Main Protease

    Get PDF
    The COVID-19 has spread worldwide and become an international pandemic. The promising target for drug discovery of COVID-19 was SARS-CoV-2 Main Protease (Mpro), that has been successfully crystallized along with its inhibitor. The discovery of peptide-based inhibitors may present better options than small molecules for inhibitor SARS-CoV-2 Mpro. Natural compounds have such a wide potential and still few explored, Zizyphus spina-christi is one of the medicinal plants that have many pharmacological activities and contains a peptide compound from alkaloids class, i.e. cyclopeptide alkaloids, that is interesting to explore as SARS-CoV-2 Mpro inhibitor. The compound structure was drawn and optimized using density functional theory 3-21G method. The protein chosen was the high resolution of SARS-CoV-2 MPro receptor (1.45 Å) with PDB ID: 6WNP, in complex with boceprevir. Molecular docking simulation was performed using Autodock4 with 100 numbers of GA run, the validation methods assessed by RMSD calculation. Furthermore, the prediction of pharmacological activity spectra was carried out using the PASS Prediction server. The results showed RMSD value was 1.98 Å, this docking method was valid. The binding energy of all compounds showed better results than the native ligand (Boceprevir). The in silico PASS prediction results indicated that all compounds showed antiviral activity. Some compounds showed protease inhibitory activity, i.e Ambiphibine-H, Franganine, and Mauritine-A, and the highest Pa (Predicted activity) value showed by Mauritine-A compounds. It can be concluded that the cyclopeptide compounds of Zizyphus spina-christi were indicated to have a potential as COVID-19 therapy targeting SARS-CoV-2 Mpro

    The Morphological and Anatomical Studies of The Aerial Parts of Abroma augusta L. from Semarang

    Get PDF
    Abroma augusta L. known as Devil’s cotton belongs to Malvaceae. The exploratory study aimed to study the morphological and anatomical characteristics of the aerial parts of A. augusta L. from Semarang. The transverse section of the aerial parts was made by a simple method (fresh preparation) and then observed under a binocular microscope with an optilab. All characteristics were observed and then compared with the references. The collected data were analyzed descriptively and quantitatively. In summary, the results showed that A. augusta L. was an evergreen shrub (small tree) with orthotropic and plagiotropic branches and polymorphous leaves. The inflorenscence was found in the terminal and axillar plagiotropic branching with bisex, actinomorphic, and pentamerous flowers. The fruit was unique (obconical capsule with a rounded base and truncate-tip with 5 angled wings) including cotton fibers and numerous black seeds. The petiole was composed of epidermis, collenchyma, cortical parenchyma, sclerenchyma, vascular bundle, mucilaginous ducts, and pith. The dorsiventral leaf was composed of upper and lower epidermis, palisade, and spongy parenchyma. The stomata type was ranunculaceous (anomocytic) while the guard cell was kidney-shaped. The stomata density on the abaxial leaf was higher than that of the adaxial leaf. The stellate and unicellular non-glandular trichomes, and capitate glandular trichomes were found abundantly on the petiole and leaf blade. These morphological and anatomical studies are important to support the identification as a part of the conservation effort of the plant. Further studies are recommended to investigate the root morphology and anatomy and also biochemical characteristics of each part of the plant in order to obtain  complete plant identification

    The Ethnobotany Study of The Foodstuffs by Local Communities in The Bulumario Village, North Sumatera

    Get PDF
    Food is a primary human need. Various foods are initially obtained from plant species. Village people have used various food plants based on local knowledge and belief. The aims of this research were to elucidate (1) various food plants traditionally utilization by local people of the Bulumario Village, North Sumatra; (2) plant organs of food plants that are traditionally used by the local people of Bulumario village. The method used in this study was qualitative. Data were collected through surveys, interviews, and participatory observation. A total of 46 respondents were interviewed consisting of 22 men and 24 women who determined by purposive sampling. Data were analyzed was descriptively using descriptive statistics. A total of 83 species belonging to 66 genera and 36 families have been used by local communities in Bulumario village as foodstuffs. Those used as a source of carbohydrates (7 species), fruit sources (15 species), vegetables (32 species), and spices (21 species). Based on plant part used, the foodstuffs are fruit (34 species), leaves (21 species), and stems (13 species).  The composition of food plants are cultivated (53 species), wild (18 species), and semi-cultivated (12 species). Solanum torvum, Garcinia attrovidis, Etlingera elatior, and Zanthoxylum acanthopodium are spices especially in Bulumario Village which have bioactivity as an antimicrobial so they are potential to be developed as a natural preservative. Pakkat (Calamus hookerianus, Calamus metzianus, Calamus thwaitesii and Plectocomiopsis geminiflora) have the potential to be developed as a vegetable or carbohydrate source

    Molecular Identification and Morphological Characterization of Ficus sp. (Moraceae) in Bogor Botanic Gardens

    Get PDF
    Ficus spp. belongs to the tribe Ficeae in the Moraceae family. Many members of this genus have been collected and grown in Bogor Botanic Gardens. There are 519 living collections of Ficus conserved since 1817, and 13 of them have not been identified until the species level. This research aimed to identify the Ficus sp. originated from Kaur Selatan (Bengkulu) using morphological and molecular approaches. Morphological characterization and herbarium specimen observation have been carried out to identify the Ficus sp. The molecular approach was conducted through DNA barcoding using ITS primer. The molecular identification using ITS sequence showed that Ficus sp. is Ficus crassiramea with 99.87% similarity to the sequence in NCBI. Morphological observation through herbarium specimen showed that there are 9 vegetative characters specific to Ficus crassiramea

    Bryophyte Diversity in Mount Prau, Blumah Village, Central Java

    Get PDF
    Bryophytes are a major component of the ecosystem in Indonesia. Due to their sensitiveness, the abundance and diversity of bryophytes in an ecosystem are influenced by environmental conditions. This study aimed to determine the diversity of bryophytes based on ecological parameters in the village of Blumah Kecaman Plantungan, Kendal Regency which is directly adjacent to the Mount Prau protected forest, Central Java. The data collection method used was the exploratory method and the descriptive exploratory method with survey techniques. Observation was carried out by exploring an area of  3 kilometers, every 1 km distance. An observation station was made consisting of station 1 Jiwan hamlet, station 2 Garung, and station 3 at Cengkek and Gondan springs. The specimens were identified based on taxonomic literature. Each species was collected as a specimen for further identification in the laboratory. Abiotic environment parameters such as temperature, humidity, altitude, light intensity, pH and slope were observed. The results showed that Blumah village still has high plant diversity, especially bryophytes. The more humid, the higher the place, the lower the temperature and light intensity, the more species diversity. Based on the identification results, 21 species were recorded, which includes 15 species of mosses, 4 species of liverworts, and 2 species of hornworts. The index value of bryophyte species diversity was in the medium category, and the index value of species richness and species dominance were at low levels

    234

    full texts

    256

    metadata records
    Updated in last 30 days.
    Jurnal Biodjati
    Access Repository Dashboard
    Do you manage Open Research Online? Become a CORE Member to access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard! 👇