Al-Kauniyah: Jurnal Biologi
Not a member yet
398 research outputs found
Sort by
Carcass Weight and Skeletal Muscle Microscopic Structure of Red Nile Tilapia (Oreochromis niloticus) in The Different Aeration and Filtration
Get PDFAbstractRed tilapia (Oreochromis niloticus) is a freshwater fish that widely liked by Indonesian people. Keeping fish with good water quality will increase productivity. The aim of this research was to determine the effect of adding aeration and using filters on carcass weight, muscle fiber diameter and number of muscle fibers in red tilapia. This research used 24 red tilapia fish with an initial body weight of around 7 g. Divided into 4 groups, namely the maintenance group using one aerator without a filter (ANF), the maintenance group using two aerators without a filter (AANF), the maintenance group using one aerator and using a filter (AF) and the maintenance group using two aerators and using a filter (AAF). The results showed that rearing red tilapia fish in the group rearing two aerators and using a filter had a significant effect (P <0.05) on carcass weight, muscle fiber diameter, and number of muscle fibers. Observation of the muscle histology structure showed that there was no damage to the muscle histology structure. The conclusion of this research indicate that additional aerator equipped with filters will supports the growth of red tilapia fish.AbstrakIkan nila merah (Oreochromis niloticus) merupakan ikan yang banyak disukai masyarakat Indonesia. Pemeliharaan ikan dengan kualitas air yang baik akan memberikan peningkatan produktivitas. Tujuan penelitian ini adalah mengetahui pengaruh penambahan aerasi dan penggunaan filter terhadap bobot karkas, diameter serabut otot serta jumlah serabut otot pada ikan nila merah. Penelitian ini menggunakan 24 ekor ikan nila merah dengan bobot badan awal berkisar 7 g. Dibagi menjadi 4 kelompok, yaitu kelompok pemeliharaan menggunakan satu aerator tanpa filter (ANF), kelompok pemeliharaan menggunakan dua aerator tanpa filter (AANF), kelompok pemeliharaan menggunakan satu aerator dan menggunakan filter (AF) serta kelompok pemeliharaan menggunakan dua aerator dan menggunakan filter (AAF). Hasil menunjukkan pemeliharaan ikan nila merah pada kelompok pemeliharaan dua aerator dan menggunakan filter berpengaruh nyata (P <0,05) terhadap bobot karkas, diameter serabut otot, dan jumlah serabut otot. Pada pengamatan struktur histologi otot menunjukkan tidak adanya kerusakan struktur histologi otot. Kesimpulan penelitian ini penambahan aerator dilengkapi filter mendukung pertumbuhan ikan nila merah
Characterization of Peronosclerospora maydis and Its Effect on Plant Growth and Disease Incidence Under Fungicides Treatment on Maize (Zea mays L.)
Get PDFAbstractDowny mildew disease on maize (Zea mays L.) is generally caused by fungi from the genus Peronosclerospora. This study aims to identify the type of fungi that cause downy mildew in Sleman, to determine the effect of a fungicide on the growth of maize plants, the disease incidence, and severity. Fungi isolates were taken from the maize plantation area in Tirtoadi Village, Sleman. Observation of fungal spores was carried out using a binocular microscope. Application of metamorph (PMD), metalaxyl (PMMe), propineb (PMP), and mancozeb (PMMz) fungicides was carried out when the plants were 7 days after planting (DAP). Maize plants were inoculated with downy mildew spores when the plants were 8 DAP. The parameters measured were plant height, number of leaves, fresh weight, dry weight, disease incidence, and severity. Data were analyzed by ANOVA using SPSS version 23 and tested by Duncan Multiple Range Test (DMRT). The results showed that the fungi causing downy mildew in Sleman was Peronosclerospora maydis. Plants treated with mancozeb (PMMz) had the highest growth in plant height, number of leaves, fresh weight, and dry weight, followed by PMP, PMD, and PMMe treatments. The results of the DMRT test showed that the disease incidence and disease severity of PMD, PMMe, and PMP were significantly reduced compared to the P. maydis (PM) treatment. Plants with metalaxyl treatment had the highest ability to reduce disease severity by 92.70%, followed by prominent at 78.10%, metamorph 58.66%, and mancozeb 16.79%.AbstrakPenyakit bulai pada tanaman jagung (Zea mays L.) umumnya disebabkan oleh jamur dari genus Peronosclerospora. Penelitian ini bertujuan untuk mengidentifikasi jenis jamur penyebab penyakit bulai di Sleman, mengetahui pengaruh fungisida terhadap pertumbuhan tanaman jagung, kejadian, dan keparahan penyakit. Isolat jamur diambil dari area persawahan Desa Tirtoadi, Sleman. Pengamatan spora jamur dilakukan dengan menggunakan mikroskop binokuler. Pemberian fungisida dimetomorf (PMD), metalaksil (PMMe), propineb (PMP), dan mankozeb (PMMz) dilakukan saat tanaman berumur 7 hari setelah tanam (HST). Tanaman jagung diinokulasi dengan spora bulai pada saat tanaman berumur 8 HST. Parameter yang diukur adalah tinggi tanaman, jumlah daun, berat basah, berat kering, kejadian penyakit, dan tingkat keparahan. Data dianalisis dengan ANOVA menggunakan SPSS versi 23 dan diuji dengan Duncan Multiple Range Test (DMRT). Hasil penelitian menunjukkan bahwa jamur penyebab bulai di daerah Sleman adalah P. maydis. Tanaman dengan perlakuan PMMz memiliki pertumbuhan tinggi tanaman, jumlah daun, berat basah, dan berat kering tertinggi, diikuti dengan perlakuan PMP, PMD, dan PMMe. Hasil uji DMRT menunjukkan angka kejadian penyakit dan keparahan penyakit pada perlakuan PMD, PMMe, dan PMP menurun secara signifikan dibandingkan dengan perlakuan P. maydis (PM). Tanaman dengan perlakuan metalaksil memiliki kemampuan terbaik dalam menurunkan keparahan penyakit sebesar 92,70%, kemudian propineb 78,10%, dimetomorf 58,66%, dan mankozeb 16,79%.
Phytoplankton Diversity as Bioindicator of Pollution in Jenes River, Surakarta
Get PDFAbstractThis research aims to identify the types of phytoplankton, identify the abundance of phytoplankton, and study the relationship between environmental factors and the abundance of phytoplankton. This research was carried out on January 10, 2023, at the Jenes River, Surakarta. Sampling was carried out at 3 observation stations to identify environmental factors (pH, DO, CO2, salinity, BOD, light intensity, temperature, and brightness). Observations were carried out at three stations, namely upstream, middle and downstream, namely, in the morning (06.00–07.00 WIB) and during the day (12.00–14.00 WIB). Measurements of environmental factors were carried out at the integrated laboratory at Sebelas Maret University, Surakarta. The results of the research showed that the phytoplankton found were 9 families consisting of 11 species with an average abundance of 6,834 individuals/L in the morning day and an average abundance of 13,088 individuals/L during the day. The most abundant phytoplankton in the morning observations was Ulothrix sp. Meanwhile, the most abundant phytoplankton in the afternoon observations was Chroococcus sp. This abundance is also influenced by environmental factors such as pH, DO, Salinity, BOD, CO2, and temperature. The research found that the middle station had the highest phytoplankton diversity index during the day (1.6), possibly because it was indicated to be lightly polluted, allowing the life of many phytoplankton such as Closterium sp. and Quadrigula sp. The highest abundance of phytoplankton in the morning is Ulothrix sp., in the afternoon, it is Chroococcus sp.AbstrakPenelitian ini bertujuan untuk mengidentifikasikan jenis fitoplankton, kelimpahan fitoplankton, dan analisis hubungan faktor lingkungan dengan kelimpahan fitoplankton di Sungai Jenes Surakarta. Penelitian ini dilaksanakan pada 10 Januari 2023 di Sungai Jenes, Surakarta. Pengambilan sampel dilakukan di 3 stasiun pengamatan untuk mengukur faktor lingkungan (pH, DO, CO2, salinitas, BOD, intensitas cahaya, suhu, dan kecerahan). Pengamatan dilakukan di tiga stasiun yaitu hulu, tengah dan hilir sebanyak 2 yaitu, pagi hari (06.00–07.00 WIB) dan siang hari (12.00–14.00 WIB). Pengujian faktor lingkungan dilakukan di laboratorium terpadu Universitas Sebelas Maret, Surakarta. Hasil penelitian menunjukkan bahwa fitoplankton ditemukan berjumlah 9 famili terdiri dari 11 spesies dengan rata-rata kelimpahan 6.834 individu/L pagi hari dan rata rata kelimpahan 13.088 individu/L pada siang hari. Fitoplankton yang paling melimpah pada pengamatan pagi hari adalah Ulothrix sp., sedangkan siang hari adalah Chroococcus sp. Kelimpahan ini juga dipengaruhi oleh faktor lingkungan seperti pH, DO, Salinitas, BOD, CO2 , dan suhu. Penelitian menemukan bahwa stasiun tengah memiliki indeks keanekaragaman fitoplankton tertinggi pada siang hari (1,6), kemungkinan karena terindikasi tercemar ringan, memungkinkan hidupnya banyak fitoplankton seperti Closterium sp. dan Quadrigula sp. Kelimpahan fitoplankton tertinggi pada pagi hari adalah Ulothrix sp., sementara pada sore hari adalah Chroococcus sp.
Effect of EM4 (Effective Microorganism 4) on Growth and Productivity of Cucumber (Cucumis sativus L.)
Get PDFAbstractCucumber (Cucumis sativus L.) is a nutritious and healthy vegetable that is commonly consumed by Indonesian people. To fulfill self-sufficiency for household scale needs during the COVID-19 pandemic, cucumber cultivation can be carried out in home gardens, using containers such as polybags. Growing cucumbers on limited land requires a carefully optimized planting media composition by applying Effective Microorganism 4 (EM4) to the polybag media when planting. The research has been conducted which aims to determine the best EM4 dosage for the growth and productivity of cucumbers. The study used a Randomized Block Design consisting of control and three treatment doses of 10% concentration EM4, namely 20, 40, and 60 mL per polybag with six replications. The planting media used is a mixture of loam soil and goat manure. NPK fertilizer is given as an additional nutrient. The EM4 application is done by pouring it every eight days into the planting media in polybags. The results showed an increase in growth parameters and productivity of cucumber plants namely plant height, leaf chlorophyll content, time of flower emergence, number of flowers, and number of flowers that form fruit. 40 mL EM4 is the dose that showed the highest growth and productivity.AbstrakMentimun (Cucumis sativus L.) merupakan sayuran bergizi dan menyehatkan yang banyak dikonsumsi masyarakat Indonesia. Untuk memenuhi swasembada kebutuhan skala rumah tangga di masa pandemi COVID-19, budidaya mentimun dapat dilakukan di pekarangan rumah, dengan menggunakan wadah polybag. Menanam mentimun di lahan terbatas memerlukan optimalisasi komposisi media tanam secara cermat dengan menerapkan Effective Microorganism 4 (EM4) pada media dalam polybag. Telah dilakukan penelitian yang bertujuan untuk mengetahui dosis EM4 terbaik untuk pertumbuhan dan produktivitas tanaman mentimun. Penelitian menggunakan Rancangan Acak Kelompok yang terdiri atas kontrol dan tiga perlakuan dosis EM4 konsentrasi 10% yaitu 20, 40, dan 60 mL per polybag dengan enam ulangan. Media tanam yang digunakan adalah campuran tanah lempung dan kotoran kambing. Pupuk NPK diberikan sebagai unsur hara tambahan. Penerapan EM4 dilakukan dengan cara disiram setiap delapan hari sekali ke dalam media tanam di polybag. Hasil penelitian menunjukkan adanya peningkatan parameter pertumbuhan dan produktivitas tanaman mentimun yaitu tinggi tanaman, kandungan klorofil daun, waktu munculnya bunga, jumlah bunga, dan jumlah bunga yang membentuk buah. Dosis yang menunjukkan pertumbuhan dan produktivitas tertinggi adalah 40 mL EM4
The Quantification of Lead Heavy Metals Levels on Mujair Fish (Oreochromis mossambicus) Organs From Brantas and Bengawan Solo River, East Java Province, Indonesia
Get PDFAbstractOreochromis mossambicus (O. mossambicus) frequently found in the Brantas and Bengawan Solo rivers, Java island, Indonesia. However, heavy metals produced from anthropogenic activities can enter the water and accumulate in organisms living in the river. This study aimed to determine the lead (Pb) heavy metal in the gills, flesh, and intestines of O. mossambicus living in the two aforementioned rivers and to measure the Pb levels in each river. The results showed that the Pb in the O. mossambicus organs in the Bengawan Solo river was as follows 3.159 mg/kg in the gills; 1.930 mg/kg in the intestine; and 2.511 mg/kg in flesh, while in the Brantas river it was follows 1.600 mg/kg in gills; 1.402 mg/kg in the intestine; and 1.455 mg/kg flesh. Pb levels in each river water were 0.568 mg/mL in the Brantas river and 0.525 mg/mL in the Bengawan Solo river. Based on the data obtained, it can be concluded that the Pb content in fish organs and river water has exceeded the quality standard for Pb levels according to the government regulation No.82 2001 (SNI 7387:2009), that is, 0.3 mg/kg in organs and 0.03 mg/L in water. The results of this study are expected to be a concern for the authorities in order to revitalize the river to restore the function and support the survival of river biota.AbstrakIkan mujair (Oreochromis mossambicus) banyak ditemukan di sungai Brantas dan Bengawan Solo, namun aktivitas antropogenik yang menghasilkan logam berat dapat masuk ke perairan sehingga terakumulasi dalam organisme yang hidup di perairan tersebut. Penelitian ini bertujuan untuk mengetahui kandungan logam berat timbal (Pb) pada insang, daging, dan usus pada O. Mossambicus yang hidup di kedua sungai tersebut serta mengukur kandungan Pb pada masing-masing air sungai. Hasil penelitian menunjukkan bahwa kandungan Pb pada organ O. mossambicus di sungai Bengawan Solo adalah sebagai berikut 3.159 mg/kg pada insang; 1.930 mg/kg di usus; dan 2.511 mg/kg pada daging, sedangkan di sungai Brantas adalah sebagai berikut 1.600 mg/kg pada insang; 1,402 mg/kg pada usus; dan 1,455 mg/kg pada daging. Kadar Pb pada masing-masing air sungai adalah 0,568 mg/mL (sungai Brantas) dan 0,525 mg/mL (sungai Bengawan Solo). Berdasarkan data yang diperoleh dapat disimpulkan bahwa kandungan Pb pada organ ikan maupun air sungai sudah melebihi baku mutu kadar Pb pada organ yaitu 0,3 mg/kg (SNI 7387:2009) dan 0,03 mg/L pada perairan (PP No.82 tahun 2001). Hasil penelitian ini diharapkan dapat menjadi perhatian pihak-pihak terkait agar dapat melakukan revitalisasi sungai guna mengembalikan fungsi dan mendukung keberlangsungan hidup biota sungai
The Diversity of Plant as Traditional Culinary Food Wrappers on The Bogor’s Society, West Java Province, Indonesia
Get PDFAbstractTraditional culinary is a food that has a distinctive taste, commonly consumed by a particular society. Generally, traditional culinary using the diversity of plants to wrap food. The function of plant leaves for food wrapping in consider of natural and safe material. The use of natural materials is very valuable traditional knowledge and includes cultural wealth. The research was conducted to reveal the diversity of plants that are still used as traditional culinary wrapping in Bogor city. This research method used the ethnobotany approach, through observation and direct interview to a key informant up to 20 respondents on the three traditional market’s in Bogor city. The data collection results were produced of 23 types of cuisines in the traditional culinary markets, namely Anyar/Kembang, Sukasari, and Surya Kencana. These traditional culinary are utilized five plant species to wrap food, mostly using banana leaves (Musa spp.) for food packaging of 23 types of the tradisional culinary delights. The advantage of utilizing plants as traditional culinary wrapping infused with flavor to enhance the taste and art. Utilization plants as food wrapping need to preserved, developed, and socialized to public due to its local wisdom environmental sustainability and to reduce the use of non-natural resources that have severe environmental impacts and public health.AbstrakKuliner tradisional merupakan suatu makanan yang mempunyai cita rasa yang khas, biasa dikonsumsi oleh masyarakat tertentu. Umumnya kuliner tradisional memanfaatkan keanekaragaman tumbuhan sebagai pembungkusnya. Penggunaan daun sebagai pembungkus karena bahan alami dan aman untuk membungkus makanan. Penggunaan bahan dari alam adalah pengetahuan tradisional sangat berharga dan termasuk kekayaan budaya. Penelitian tersebut dilakukan untuk mengungkap keanekaragaman tumbuhan yang masih digunakan sebagai pembungkus kuliner tradisional di Kota Bogor. Metode penelitian menggunakan pendekatan etnobotani, melalui observasi dan wawancara langsung kepada informan kunci sebanyak 20 responden di tiga pasar tradisional kota Bogor. Hasil pendataan menunjukkan terdapat 23 jenis kuliner tradisional di pasar Anyar/Kembang, Sukasari, dan Surya Kencana. Kuliner tradisional ini memanfaatkan 5 jenis tumbuhan sebagai pembungkusnya yang sebagian besar adalah daun pisang (Musa spp.) yang digunakan sebagai pembungkus 23 kuliner tradisional. Keuntungan memanfaatkan tumbuhan sebagai pembungkus kuliner tradisional antara lain untuk menambah cita rasa dan seni. Pemanfaatan tumbuhan sebagai pembungkus makanan perlu dilestarikan, dikembangkan, dan disosialisasikan kepada masyarakat umum agar budaya lokal ini senantiasa lestari dan dapat mengurangi pemanfaatan sumber daya non alam yang berdampak buruk terhadap lingkungan dan kesehatan masyarakat
Isolation And Characterization of Bacteria from Shallots (Allium cepa L.) as In-vitro Biocontrol Agent of Fusarium oxysporum f.sp cepae
Get PDFAbstractShallot is one of the leading vegetable commodities with many benefits such as for seasonings and herbal medicinal ingredients. The demand for shallots continues to increase; however, shallot production is still relatively low. One of the limiting factors causing low shallot production is due to wilt disease caused by Fusarium oxysporum f.sp cepae (Foc). Bacteria have many roles in suppressing the growth of Foc, and this study aims to obtain potential bacterial isolates from the shallot plant to inhibit the growth of Foc Based on fungal diameter zone inhibition, degree of inhibition, and chitinase test, it was obtained 9 isolates which could suppress the growth of Foc. The results indicated that the AB3, TB2, and UB1 bacterial isolates could inhibit the growth of Foc with a percentage of inhibition of 46.80; 40.24; and 35.11%, respectively. The analysis showed that AB3, TB2, and UB1 isolates were categorized as moderate in suppressing the growth of Foc. The 16S rRNA sequencing results showed that AB3 and TB2 isolate had similarities with Bacillus subtilis by 99,75%, and 100%, respectively, while UB1 isolate had similarities with Pseudomonas nitroreducens by 89,35%. Based on the result showed that Bacillus sp. AB3 and TB2 isolates, and P. nitroreducens UB1 isolate have more potential as biological control agents to control the Fusarium wilt at in vitro assay. The field efficacy studies on these potential antagonists need to be done in the future.AbstrakSalah satu faktor pembatas yang menyebabkan rendahnya produksi bawang merah adalah penyakit layu yang disebabkan oleh Fusarium oxysporum f.sp cepae (Foc). Bakteri antagonis memiliki banyak peran dalam menekan pertumbuhan Foc, dan penelitian ini bertujuan untuk mendapatkan isolat bakteri antagonis potensial asal tanaman bawang merah untuk menghambat pertumbuhan Foc. Berdasarkan nilai zona hambat diameter jamur, derajat hambat dan uji kitinase, diperoleh 9 isolat yang dapat menekan pertumbuhan Foc. Hasil penelitian menunjukkan bahwa isolat bakteri AB3, TB2, dan UB1 mampu menghambat pertumbuhan Foc dengan persentase penghambatan masing-masing sebesar 46,80; 40,24; dan 35,11% dengan kategori penghambatan pertumbuhan Foc moderat. Hasil sekuensing 16S rRNA, menunjukkan bahwa isolat AB3 dan TB2 memiliki kemiripan dengan Bacillus subtilis masing-masing sebesar 99,75%, dan 100%, sedangkan isolat UB1 memiliki kemiripan dengan Pseudomonas nitroreducens sebesar 89,35%. Berdasarkan hasil penelitian menunjukkan bahwa Bacillus sp. isolat AB3, TB2, dan P.nitroreducens isolat UB1 berpotensi digunakan sebagai agen pengendali hayati untuk mengendalikan penyakit layu Fusarium pada uji in vitro. Studi kemanjuran lapangan terhadap isolat antagonis potensial ini perlu dilakukan di masa depan
Aktivitas Antimikroba Ekstrak Biji Rotan Manau (Calamus manan Miq.) Terhadap Salmonella typhi dan Candida albicans
Get PDFAbstrakDemam tifoid adalah penyakit demam akut yang disebabkan oleh infeksi bakteri Salmonella typhi. Kandidiasis oral merupakan infeksi yang disebabkan oleh fungi Candida albicans yang banyak terdapat pada mukosa rongga mulut. Tujuan dari penelitian yaitu mengidentifikasi aktivitas antimikroba ekstrak biji rotan manau (Calamus manan Miq.) terhadap S. typhi dan C. albicans. Metode ekstraksi yang digunakan adalah metode maserasi dengan pelarut etanol 96%. Skrining antimikroba ekstrak biji rotan manau menggunakan metode well-diffusion. Identifikasi aktivitas antimikroba ekstrak biji rotan manau terhadap S. typhi dan C. albicans untuk melihat Minimum Inhibitory Concentration (MIC) menggunakan metode broth dilution, sedangkan untuk melihat Minimum Bactericidal Concentration (MBC) terhadap S. typhi dan Minimum Fungisidal Concentration (MFC) terhadap C. albicans menggunakan metode solid dilution. Hasil skrining antimikroba didapatkan zona hambat pada ekstrak biji rotan manau terhadap S. typhi sebesar 21,39 mm dan terhadap C. albicans sebesar 16,14 mm. Nilai MIC ekstrak biji rotan manau pada konsentrasi 50% terhadap S. typhi dan C. albicans, sedangkan untuk MBC terhadap S. typhi maupun MFC terhadap C. albicans dari ekstrak biji rotan manau tidak ditemukan karena pada media padat masih ditemukannya pertumbuhan mikroba. Hasil penelitian ini diharapkan dapat menjadi acuan untuk penelitian lanjutan sebagai temuan awal senyawa potensi antimikroba dari ekstrak biji rotan manau terhadap bakteri dan fungi.AbstractTyphoid fever is an acute febrile illness caused by infection with the bacterium Salmonella typhi. Oral candidiasis is an infection caused by the fungus Candida albicans which is abundant in the oral mucosa. The purpose of this study was to identify the antimicrobial activity of rattan manau seed extract (Calamus manan Miq.) against the bacteria Salmonella typhi and the fungus C. albicans. The extraction method used is the maceration method. Antimicrobial screening of rattan manau seed extract using the well-diffusion method. Identification of antimicrobial activity of rattan manau seed extract against S. typhi bacteria and C. albicans fungi to see Minimum Inhibitory Concentration (MIC) using the broth dilution method, while to see Minimum Bactericidal Concentration (MBC) against S. typhi bacteria and Minimum Fungicidal Concentration (MFC) against the fungus C. albicans using the solid dilution method. The results of antimicrobial screening showed that the inhibition zone in the extract of rattan manau against S. typhi was 21.39 mm and against C. albicans was 16.14 mm. The MIC value of rattan manau seed extract was obtained at a concentration of 50% against S. typhi bacteria and C. albicans fungi, while for MBC against S. typhi and MFC against C. albicans from rattan manau seed extract not found because in solid media microbial growth is still found. The results of this study are expected to be a reference for further research as initial findings of antimicrobial potential compounds from the extract of manau rattan seeds against bacteria and fungi
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti
Get PDFAbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers for the COX-1 gene of A. aegypti
Morphological Characteristics of Kecombrang (Etlingera elatior (Jack) R. M. Smith) in Several Regions in Aceh Province, Sumatra
Get PDFAbstractKecombrang (Etlingera elatior) is one of the plant species of the Zingiberaceae family is widely used by the community as food and medicine. Not much research has been done on the morphological diversity of kecombrang plants in Aceh, so scientific information about these plants is still minimal. Therefore, this research needs to be carried out to enrich knowledge about these plants in the Aceh region. Sampling was conducted from January to April 2022 at three places in Central Aceh, Banda Aceh, Weh Island, and Simeulue Island. This research was carried out according to the survey method by roaming and direct collection. A total of 12 groves were collected from wild and cultivated area and observed for 43 characters consisting of quantitative and qualitative data. Based on these observations, two variations of the kecombrang plant have been found based on the color of the bracts, namely the red and pink variants. Based on morphological characters of vegetative organs, all samples of Etlingera elatior had a similarity distance coefficient from 67 to 86%. In addition, the kecombrang plants found in the highlands of Central Aceh have a larger size in leaf and inflorescent compared to samples from other locations.AbstrakKecombrang (Etlingera elatior) adalah salah satu jenis tumbuhan famili Zingiberaceae yang secara luas penggunaanya dikenal oleh masyarakat sebagai makanan dan obat. Belum banyak penelitian terkait keanekaragaman morfologi tumbuhan kecombrang di Aceh, sehingga informasi ilmiah tentang tumbuhan ini masih sedikit. Oleh karena itu penelitian ini perlu dilakukan untuk memperkaya pengetahuan tentang tumbuhan tersebut di daerah Aceh. Pengambilan sampel dilakukan pada bulan Januari hingga April 2022 di tiga tempat yaitu di Aceh Tengah, Banda Aceh, Pulau Weh, dan Pulau Simeulue. Penelitian ini dilakukan dengan metode survei dengan cara jelajah dan pengumpulan langsung. Sebanyak 12 rumpun dikumpulkan dari kawasan liar dan budi daya dan diamati sebanyak 43 karakter yang terdiri dari data kuantitatif dan kualitatif. Berdasarkan pengamatan tersebut, ditemukan dua variasi tanaman kecombrang berdasarkan warna braktea, yaitu varian merah dan merah jambu. Berdasarkan karakter morfologi organ vegetatif, seluruh sampel Etlingera elatior memiliki koefisien kemiripan dari 67 hingga 86%. Selain itu, kecombrang yang ditemukan di dataran tinggi Aceh Tengah mempunyai ukuran daun dan perbungaan yang lebih besar dibandingkan sampel dari lokasi lain