Jurnal Sain Veteriner
Not a member yet
821 research outputs found
Sort by
Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development
No full textDengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotypin
Studi Histopatologi Ren Tikus Putih (Rattus Norvegicus L.) Diabetes Setelah Pemberian Cuka dari Kulit Nanas (Ananas Comosus (L.) Mer.)
Get PDFDiabetes mellitus is a metabolic disease that occurs due to impaired insulin secretion caused by progressive damage to beta cells. Pineapple skin vinegar contained acetic acid and antioxidants which have the potential to help repaired the structure of the nephron ren and other organs affected by diabetes. The purpose of this study was to examined the effectiveness of pineapple skin vinegar on improved the histological structure of diabetic rats ( Rattus norvegicus L.). This study based on changed in the structure of the nephron in samples of normal and alloxan-induced mice pre-treatmented and post-treatmented. Twenty-four rats were divided into 6 groups, named normal control, positive control (diabetes + 0.4 mL apple vinegar), negative control (diabetes + water), dose test groups 1, 2, and 3 (pineapple vinegar 0.2 mL; 0.4 mL; 0.8 mL). Statistical analysis test used ANOVA was followed by Duncan test. The conclusion of this research, the pineapple skin vinegar showed the ability to repair the histopathological structure of white rats damaged by diabetes. The optimum dose needed was 0.8 mL to improved the histological structure of the nephron, as indicated by the glomerular diameter and the distance of the Bowman's capsule space to near normal
Peran Hemaglutinin dan Hemolisin pada Escherichia coli Sorbitol-negatif Isolat Burung Puyuh pada Proses Infeksi Secara in Vitro
Get PDFAbstract Escherichia coli sorbitol-negative in quails cause economic loss due to the death, growth rate inhibition, decreased egg production, and increased medical treatment. Escherichia coli sorbitol-negative has many virulence factors, including hemagglutinin and hemolysin. The aim of this study is to determine the role of hemagglutinin and hemolysin in the infection process of Escherichia coli sorbitol-negative in vitro. This study was performed using 23 isolates of Escherichia coli sorbitol-negative from quails, 52.2% (12 of 23 isolates) had hemagglutinin, while 34.8% (8 out of 23 isolates) had hemolysin. Isolates with hemagglutinin were more attached to human buccal epithelial cells than isolates without hemagglutinin (P <0.05). Isolates with hemolysin were less phagocyted by macrophages compared to isolates which without hemolysin (P <0.05). Escherichia coli sorbitol-negative isolates from quails that have hemagglutinin and hemolysin are pathogenic isolates that possess the potential to cause colibasilosis and transmission between quails and other birds.
UJI EFEK ANTELMINTIK INFUS BUNGA WIDURI (Calotropis gigantea) (L.) Dryand TERHADAP CACING HATI (Fasciola) SECARA IN VITRO
No full textFasciolosis merupakan penyakit parasit yang dapat menyerang sapi dan manusia disebabkan oleh Fasciola sp. Bunga widuri (Calotropis gigantea) merupakan tumbuhan obat yang telah diketahui secara tradisional dapat mengobati kecacingan. Penelitian ini bertujuan menentukan efektivitas infus bunga widuri terhadap Fasciola sp. secara in vitro dan berdasarkan gambaran histologi tegumen. Penelitian ini bersifat eksperimental, dilaksanakan pada bulan Mei sampai September 2017 di Laboratorium Biologi FMIPA, Universitas Mataram. Pengujian secara in vitro terdiri dari enam kelompok: albendazol, kontrol negatif, infus bunga widuri konsentrasi 5%, 10%, 15%, dan 30% dengan parameter indeks pergerakan relatif dan ketahanan hidup. Preparat dibuat menggunakan metode parafin dan pewarnaan hematoksilin eosin. Data hasil perhitungan in vitro dianalisis dengan uji Kruskal-Wallis dan Mann-Whitney U Test. Analisis histologi pada bagian tegumen dilakukan secara deskriptif. Secara in vitro tidak ada pengaruh nyata (p<0,05) peningkatan konsentrasi terhadap penurunan waktu kematian cacing. Preparat histologi menunjukkan peningkatan konsentrasi infus seiring peningkatan kerusakan pada tegumen. Kesimpulan dari penelitian ini konsentrasi efektif infus bunga widuri adalah 5%. Kerusakan tegumen terbesar terjadi pada konsentrasi tertinggi
Hematology Profile and Liver Histopathology in Escherichia coli Infected Layers Treated with Combination of Phyllanthus ( Phyllanthus niruri L. ) and Turmeric ( Curcuma domestica )
Get PDFColibacillosis a disease that can cause considerable economic loss, remains an important health problem. Phyllanthus (Phyllanthus niruri L) and turmeric (Curcuma domestica) are herbs that can be used as immunomodulators. This study was aimed to determine the level of safety of the combination of phyllanthus and turmeric on hematology profile and liver histopathology of layers with colibacillosis. The layers were assigned to the following of 5 groups: a) colibacillosis group without treatment, b) colibacillosis group with 500 mg/kg BW of phyllanthus, c) colibacillosis group with 300 mg/kg BW of turmeric, d) colibacillosis group with phyllanthus and turmeric combination (1:1), e) colibacillosis group with combination of phyllanthus and turmeric (1:2) . After 21 days of treatment, blood and liver sample were collected. The hematological profile (hemoglobin, hematocrit, erythrocyte and leukocyte counts) and liver histology were examined. The result were analyzed statistically by one-way ANOVA. The group that received phyllanthus had higher levels of hemoglobine, haematocrit and erythrocytes than the control group. However, no significant differences were found for the overall groups. Treatment with the combination of turmeric and phyllanthus for 21 days did not cause changes in the hematological profiles or liver histology, and therefor this herbal combination can be used as an alternative therapy for colibacillosis in layers
POTENSI ANTIBAKTERI EKSTRAK ALGA HIJAU Halimeda makroloba Decaisne DARI PERAIRAN DESA HUTUMURI KOTA AMBON
No full textPerkembangan penggunaan obat-obatan tradisional untuk membantu meningkatkan kesehatan masyarakat sudah cukup meluas, salah satu tumbuhan yang sering digunakan dalam bidang kesehatan yaitu alga hijau, penggunaan alga hijau karena memiliki senyawa metabolit sekunder yang efektif dalam menghambat pertumbuhan bakteri, namun isolasi senyawa aktif dari alga hijau yang efektif dalam menghambat pertumbuhan bakteri masih jarang dilakukan, salah satunya Halimeda makroloba Decaisne sehingga perlu dilakukuan isolasi dan identifikasi senyawa yang aktif dalam menghambat pertumbuhan bakteri. Untuk mengetahui potensi antibakteri ekstrak alga hijau Halimeda makroloba Decaisne dari perairan Desa Hutumuri Kota Ambon dapat dilakukan melalui beberapa tahapan yaitu proses pengambilan sampel, proses ekstraksi, proses uji fitokimia uji daya hambat bakteri. Berdasarkan hasil penelitian uji fitokimia menunjukan bahwa ekstrak alga hijau Halimeda makroloba Decaisne kandungan senyawa Alkoloid, Flavonoid, Terpenoid, Fenolik, dan saponin yang berperan dalam menghambat pertumbuhan bakteri Escherichia coli dan Staphylococcus aureus. Kemampuan ekstrak alga hijau Halimeda makroloba Decaisne dalam menghambat pertumbuhan bakteri Escherichia coli pada konsentrasi 10%, 20%, 40%, 60% dan 80%, dan Kemampuan ekstrak dalam menghambat bakteri Staphylococcus aureus pada konsentrasi 60% dan 80%
Daya Antelmintik Serbuk Kulit Nanas (Ananas comosus) terhadap Cacing Haemochus contortus pada Domba
Get PDFThe problem facing sheep breeders in breeding sheep was digestive tract parasite of worm (nematodiasis and haemonchosis). Resistance to anthelmintics was the reason for the study of alternative medication of H. contortus infection. It aimed at finding out the effectiveness of the application of pineapple peel powder as H. contortus anthelmintic in sheep and the dose of the pineapple peel powder as the H. contortus anthelmintic. It used 15 sheep that were assigned to 5 groups. Group I served as positive control with the application of albendazole (Kalbazen) anthelmintic, Group II was treated using the pineapple peel powder at the dose of 150 mg/kg BW. Group III was treated using the pineapple peel powder at the dose of 200 mg/kg BW. Group IV was treated using the pineapple peel powder at the dose of 250 mg/kg BW. And, Group V served as negative control without any treatment. The treatments were conducted for 14 days and the resulting statistic data were analyzed using comparative descriptive method by comparing initial data (before the treatments) and final data (after the treatments). The comparative data showed that there was significant change in the observed variables. The results of the study showed that the pineapple peel powder could be used as the anthelmintic of the H. contortus in the sheep and the dose of 250 mg/kg BW most significantly decreased the mean number of the eggs of the worm per gram of fece
Stasis urin pada Kucing: Evaluasi Klinis dan Laboratoris
Get PDFStasis urin merupakan diagnosis simtomatif yang menggambarkan tertahannya urin di dalam saluran urinaria yang biasanya ditandai dengan membesarnya vesica urinaria (VU). Gejala klinis dan hasil pemeriksaan laboratoris sangat berperan penting dalam menentukan diagnosanya. Penelitian ini bertujuan untuk mengevaluasi kejadian stasis urin pada kucing secara klinis dan laboratoris. Materi yang digunakkan di dalam penelitian ini adalah 10 ekor kucing yang menunjukkan gejala klinis kesulitan urinasi. Semua kucing diperiksa fisik secara lege artis meliputi kondisi umum dan keadaan organ urinari khususnya VU. Kucing selanjutnya diambil sampel darahnya untuk diperiksa gambaran hematologi meliputi pemeriksaan jumlah eritrosit dan leukosit, nilai hemoglobin (Hb) dan packet cell volume (PCV). Hasil pemeriksaan pada penelitian ini didapatkan bahwa semua 10 ekor kucing (100%) menunjukkan gejala klinis tidak urinasi lebih dari 24 jam, pembesaran dan distensi VU, penurunan nafsu makan dan minum, lemas dan 3 ekor kucing (30%) menunjukkan penurunan reflek kesadaran. Semua kucing dalam penelitian ini berjenis kelamin jantan, terdiri dari 8 ekor (80%) berumur 13-24 bulan dan 2 ekor (20%) berumur lebih dari 24 bulan. Hasil pemeriksaan VU menggunakan USG didapatkan adanya peradangan dinding pada 9 ekor (90%), penebalan dinding pada 7 (70%) ekor dan adanya urolit pada 9 (90%) ekor kucing. Hasil pemeriksaan hematologi didapatkan semua parameter darah yang diperiksa dalam batasan yang normal. Berdasarkan hasil penelitian ini disimpulkan bahwa stasis urin total menunjukkan gejala klinis tidak urinasi, penurunan nafsu makan, pembesaran dan distensi VU yang pada pemeriksaan menggunakan USG menunjukkan adanya keradangan dan penebalan dinding VU dan ditemukan urolit
Potensi Tepung Magot Black Soldier Fly (Hermetia illucens) sebagai Agen Antibakteri dan Immunomodulator Pakan Ternak Unggas secara In vitro
No full textTepung Magot dalam pakan unggas tidak hanya dapat digunakan sebagai alternatif sumber protein namun juga diharapkan memiliki efek antibakterial dan immunomodulator. Penelitian ini menggunakan metode in vitro untuk mengetahui efek antimikrobial dan immunomodulator tepung magot. Uji sensitivitas dilakukan dengan metode disc difusi agar, uji aktivitas fagositosis diamati pada makrofag peritoneum mencit Balb-C jantan berumur 8 minggu terhadap Staphylococcus aureus (S. aureus), serta uji tantang S. aureus terhadap tepung magot dilihat di bawah scanning electron microscopy (SEM). Data hasil uji sensitivitas dan pengamatan dengan teknik SEM dilaporkan secara deskriptif. Perbedaan aktivitas fagositosis makrofag antar perlakuan diuji dengan analisis varian satu arah dengan uji lanjut honestly significant difference (HSD) Berdasar hasil penelitian diketahui bahwa tepung memiliki 38,22% kandungan protein dengan profil asam amino yang lengkap. Kandungan asam amino tertinggi pada tepung magot adalah (7685,84 mg/kg), aspartat (5864,19 mg/kg), leusin (5034,31 mg/kg). Asam lemak esensial yang terkandung pada tepung magot adalah asam laurat (13,39%) Hasil uji sensitivitas diketahui tepung magot tidak memberikan zona hambat pada bakteri S. aureus. Introduksi tepung magot pada fagositosis secara in vitro dapat meningkatkan kinerja makrofag dengan perannya seperti opsonin berdasar pengamatan SEM. Kesimpulan dari penelitian ini adalah tepung magot potensial digunakan sebagai imunomodulator natural dan pengganti protein pakan unggas
Test the Activity of the Juice and Infusion of Rumput Kebar (Biophytum petersianum Klotzsch) againts Ascaridia galli worms in Vitro
No full textKebar grass contains active compounds that can be used as herbal ingredients in the treatment of diseases. This study was conducted to test the anthelmintic activity of grass kebar against worms Ascaridia galli in vitro. This study uses Kebar grass juice and infusion with a concentration of 15%, 30%, 45%, and 60%, and 4 repetitions. Each level of the experiment is placed in each cup containing 25 ml of solution and 5 worms. Worm mortality is recorded every 2 hours. The results showed that the juice and infusion of kebar grass were concentrations of 15%, 30%, 45%, 60% capable of killing worms with a mean time on the juice of Kebar grass respectively 9.5; 8; 7.5; 7 hours, and the average time for Kebar grass infusion is 9.5; 8.5; 8; 7.5 hours. The immersion time is a good variable to explain the variable of worm death at each concentration of treatment. There is an anthelmintic effect on grass juice and infuse kebar grass against worms Ascaridia galli in vitro. The duration of soaking and the concentration of juice and infusion of Kebar grass in this study had a significant effect on the mortality of worms. It was concluded that the juice and grass infuse kebar(Biophytum Petersianum Klotzsch) have anthelmintic effect against worms Ascaridia galli in vitro. Concentration Kebar grass juice and infuse kebar is increasing, then the shorter the time it takes to kill the worms Ascaridia galli in vitro