Asian Journal of Research in Biosciences
Not a member yet
    115 research outputs found

    The Growth Performance and Linear Body Measurements of Mongrel Rabbits in a Tropical Environment

    Get PDF
    This study investigates the growth performance and linear body measurements of mongrel rabbits raised under tropical conditions, providing empirical evidence for their viability as a sustainable protein source in Nigeria. A total of sixty progenies were used to evaluate growth traits comprising of body weight and linear body parameters in mongrel rabbits, estimate phenotypic correlations among growth traits and develop regression models to predict body weight using linear body measurements. Body weight and linear body measurements comprising; Ear length, Heart girth, Body length, Fore-limb, Hind limb and Tail length were taken from 8 weeks to 16 weeks of age. Results showed that age exerted (P < 0.05) significant influence on all growth traits. During the study period, a positive and substantial correlation was found between body weight and all linear body parameters. This implies that, an improvement in any of linear parameters will bring about an improvement in body weight vice versa. Body weight was significantly predicted using linear body measurements with high to medium degree of validity. Higher validity was observed in the multiple model when more traits where fitted into the prediction equation

    Ivermectin-induced Reproductive Toxicity in Rabbit Bucks and the Protective Role of Moringa oleifera Leaf Extract and Vitamin C

    No full text
    This study investigated the adverse effects of ivermectin (IVM) on semen quality and hormonal levels in rabbit bucks and evaluated the protective role of Moringa oleifera leaf extract (MO) and vitamin C (VC). Twenty-five rabbit bucks were divided into five groups: control (normal saline), IVM-only (0.4 mg/kg weekly), IVM+MO (0.4 mg/kg IVM + 200 mg/kg MO), IVM+VC (0.4 mg/kg IVM + 200 mg/kg), and IVM+MO+VC (0.4 mg/kg IVM + 200 mg/kg MO + 200 mg/kg VC). Semen parameters (volume, sperm count, motility, morphology, livability) and serum hormones (testosterone, FSH, LH) were assessed after 8 weeks. Results revealed significant (P=.05) declines in semen quality and hormonal levels in the IVM group compared to controls, with improvements observed in supplemented groups. The IVM+MO+VC group showed the most notable recovery, nearing control values for sperm count (105.3 vs. 132.0 x10⁶/mL), motility (69.33% vs. 83.33%), and testosterone (4.33 vs. 5.07 ng/mL). The study concludes that IVM induces reproductive toxicity through oxidative stress and endocrine disruption, which MO and VC mitigate through antioxidant actions. Combined supplementation proved most effective, suggesting its potential as a protective strategy in breeding males. Recommendations include cautious IVM use in reproductive animals and adjunct antioxidant supplementation to preserve fertility

    Growth Performance and Haematological Evaluation in Female Rabbit Fed Diets Containing Supplemental Levels of Dried Date (Phoenix dactylifera) Fruit Meal

    Get PDF
    This study was carried out to assess the growth performance and haematological profile of female rabbits that were fed dried date fruit meal (DDFM) as supplement in their diets. Thirty-six (36) female rabbits (does) were used for the study. The rabbit does were randomly allotted to 4 experimental groups in a completely randomized design with 9 does in each treatment group. The does in each treatment group were regrouped into 3 replications with 3 animals per replicate. The four experimental diets containing the dried date fruit meal at 0.00, 0.50, 1.00 and 1.50% supplemental levels respectively, were tagged T1, T2. T3, and T4. The study lasted for 168 days (24 weeks). The growth parameters that were assessed in the study were initial body weight, final body weight, total and daily body weight gain, total and daily feed intake, and feed conversion ratio. Blood samples were collected at the end of the 24 weeks study from each replicate for haematological analysis to evaluated packed cell volume (PCV), red blood cells (RBC), white blood cells (WBC), hemoglobin (HB), mean corpuscular hemoglobin (MCH), mean corpuscular haemoglobin concentration (MCHC), mean corpuscular volume (MCV), Neutrophils, monocytes, eosinophils, basophils and lymphocytes. The results revealed that there were significant differences (P=.05) in final body weight, total body weight gain, daily body weight gain, and feed conversion ratio of the does across the treatments. The results revealed significant effects (P=.05) of the DDFM on Packed Cell Volume (PCV), Platelet count, and Haemoglobin (Hb) concentration. The PCV value was highest for the does fed diet T3 (36.67%), which was significantly higher than the values recorded for the animals fed on diets T1 (30.33%) and T2 (30.67%). Conclusion: including DDFM as supplement in rabbit does diets at 1.00% can improve growth traits and haematological indices, to enhance the overall health status of rabbits

    Hemipteran Insect Pests Associated with Different Agricultural Crops from Chhatrapati Sambhajinagar (M.S), India

    Get PDF
    A field investigation was conducted in Chhatrapati Sambhajinagar, Maharashtra, from May 2023 to April 2024 to look into the seasonal occurrence of hemipteran pests in different agricultural sectors. In this study, 10 hemipteran insect species from 9 genera, 6 families, and 8 subfamilies were collected from the study area. The Aphididae family was the most abundant. This study aimed to give a brief overview of hemipteran insects and the damages they cause to agricultural crops in the Chhatrapati Sambhajinagar district

    Modulating Serum Biochemistry, Lipid Profile, and Antioxidants Defense in Rabbit Bucks with Dried Date Palm Fruit (Phoenix dactylifera) Meal Supplementation

    Get PDF
    The aim of this study was to investigate the effects of dietary supplementation with dried date palm fruit meal (DDFM) on serum biochemistry, lipid profile, and antioxidant defense mechanisms in rabbit bucks. A total of thirty-six (36) male rabbits between the age of 8–10 weeks were used for the study. The rabbits were randomly allocated to the to four dietary treatments in a completely randomized design designated as T1 (0.00% DDFM, control), T2 (0.50% DDFM), T3 (1.00% DDFM), and T4 (1.50% DDFM) in a 168-day (24 weeks) study. Each treatment was further replicated three time to have three rabbits per replicate. At the end of the feeding trial, blood samples were collected from the ear vein for biochemical, lipid profile and serum antioxidant examinations. The data obtained were analyzed in a one-way analysis of variance (ANOVA) using SPSS version 20. The Serum biochemical analysis indicated significant reductions (p < 0.05) in total protein, albumin, urea, and alanine aminotransferase (ALT) levels with increasing DDFM supplementation, while aspartate aminotransferase (AST) and globulin levels exhibited a dose-dependent increase. The mean globulin was higher (p<0.05) in bucks fed T3 diet, with a mean value of 34.00 g/dL than in those fed T1, T2, and T4 diets respectively, which all had similar statistical values of 26.50, 23.00, and 22.50 g/dL respectively. Lipid profile analysis revealed significant (p < 0.05) alterations, with elevated triglycerides and total cholesterol at 1.50% and 1.00% DDFM inclusion, respectively, while high-density lipoprotein (HDL) levels remained unaffected. Antioxidant enzyme activities, including superoxide dismutase (SOD), glutathione (GSH), and catalase (CAT), increased significantly (p < 0.05) in response to DDFM supplementation, suggesting enhanced oxidative stress resistance. These findings therefore, indicate that DDFM supplementation at 1.00% can modulate key metabolic biomarkers and improves antioxidant defense mechanisms in rabbit bucks. However, higher inclusion levels may pose potential risks related to lipid metabolism

    Semen Characteristics, Reproductive Hormones and Testicular Histology of Male Rabbits Fed Dietary Supplemental Levels of Dried Date Palm (Phoenix dactylifera) Fruit Meal

    Get PDF
    The testis is the primary sex organ in the male reproductive system that is responsible for the production of semen. This study investigated the effects of dietary supplementation with dried date palm fruit meal (DDFM) on semen characteristics, reproductive hormone profiles, and testicular histology in male rabbits. Thirty-six grower rabbit bucks aged 8–10 weeks old used for the study were randomly assigned to four dietary treatments in a completely randomized design as follows; T1 (0.00% DDFM), T2 (0.50% DDFM), T3 (1.00% DDFM), and T4 (1.50% DDFM). Each treatment was replicated thrice with 3 rabbits per replicate in a study that lasted 24 weeks. At the end of the experiment, semen samples, blood and testicular samples were collected for laboratory examinations. Results indicated that dietary inclusion of DDFM significantly improved semen volume, sperm concentration, percentage of live sperm cells, and total sperm count per ejaculate compared to the control. Although sperm motility was not significantly influenced (P>0.05), morphological abnormalities decreased in DDFM-supplemented groups. Rabbit bucks in T2, T3 and T4 had higher similar sperm concentration values of 86.67, 92.00, and 92.33 x 106/ml, respectively, than those in T1 (77.00 x 106/ml). Hormonal analysis showed increased (P=0.05) follicle-stimulating hormone (FSH) and luteinizing hormone (LH) levels with supplementation, whereas testosterone levels varied among treatments. Testicular histology revealed no pathological changes in the control, while seminiferous tubules in treated groups exhibited varying degrees of hypertrophy, vacuolation, and sporadic germinal epithelial degeneration, particularly at higher supplementation levels. These findings suggest that moderate inclusion of DDFM (1.00%) enhances semen quality and reproductive hormone profiles in rabbit bucks but may induce mild histological changes at higher doses

    Assessing Non-synonymous Single Nucleotide Polymorphism of IGF-1 Gene Sequence in Three Nigerian Local Chicken Strains

    Get PDF
    Local chicken strains – normal feathered, frizzle feathered and naked neck – were used in this study to assess the single nucleotide polymorphism of insulin like growth factor -1 (IGF-1) gene. A total of sixty (60) chickens (twenty (20) from each strain, from which fifteen (15) - five (5) was sampled per strain for blood collection and DNA extraction) were involved in the work. Jena Bioscience Gmbh preparation kit was used in extracting DNA, while the Shine Gene Primers given by:  GTCGGGCTACTTGAGTTACTAC – Forward. TTGCGCAGGCTCTATCTGCTC   -   Reverse. was used to identify genomic DNA for sequencing of the gene (IGF-1). 2% agarose gel was used to assess the DNA purity. Results showed the polymorphism of IGF-1 gene in these strains with the neutral (beneficial) variants being more predominant and as such the tendency to influence the expression of more traits. Thus, making IGF-1 a marker of interest in the genomic selection of chicken for development and improvement

    Nanomaterials to Encapsulate Bacteria for Biological Applications

    Get PDF
    Nanotechnology has developed as a ground-breaking field with enormous potential for a wide range of applications, including biotechnology, medicine, and environmental cleanup. One intriguing use is encasing bacteria in nanomaterials to improve and control their biological functions. In order to modify the biological functions of bacteria, various forms of nanomaterials are employed to encapsulate them. Through the goal of utilizing bacteria-encased nanoparticles for targeted drug delivery, bioremediation, and biotherapeutic interventions, researchers have been investigating various nanomaterials in recent years. Due to their changeable surface characteristics, metallic nanoparticles, such gold and silver nanoparticles, enable precise control over bacterial contact. Additionally, encapsulated bacteria benefit from the protective habitats provided by polymeric nanomaterials like liposomes, micelles, and hydrogels, which improves their survival and activity. The use planned and the desired interaction with the bacteria that are enclosed influence the choice of nanomaterial. The viability and activity of encapsulated bacteria can be affected by a variety of encapsulation methods, including physical adsorption, covalent bonding, and layer-by-layer construction. Researchers may design novel systems that harness bacteria's biological activity for a variety of purposes by using the features of nanomaterials and improving encapsulation methods. To turn these encapsulation technologies into useful and secure applications, there are still issues to be solved, including as long-term stability, biocompatibility, and regulatory concerns. In conclusion, the integration of bacteria with nanomaterials opens up new avenues for manipulating their biological functions. As nanotechnology continues to evolve, the synergy between nanomaterials and encapsulated bacteria holds great promise for revolutionizing fields such as medicine, biotechnology, and environmental science

    Managing Marigold Insect Pests: Effective Control Strategies

    Get PDF
    Marigolds (Tagetes spp.) are well-liked ornamental plants that have a variety of uses in the landscape and colorful blooms. They are, however, prone to a variety of insect pests that can harm their development and appearance. This study's main objective is to evaluate integrated pest management (IPM) strategies that reduce the usage of chemical pesticides and support environmentally friendly pest management. A comprehensive pest management strategy must include cultural practices including crop rotation, trap cropping, and maintaining garden hygiene. Utilizing advantageous insects like parasitoids and predators aids in biological control and lessens the need for chemical treatments. Furthermore, we assess the use of natural therapies like neem oil and Bacillus thuringiensis as secure and sustainable substitutes for conventional pesticides. For these therapies to be effective, time and accuracy are essential. The need for routine inspection and early insect infestation detection is also emphasized in this abstract to protect marigold plants from severe harm. Successful and long-lasting marigold pest management can be achieved by putting a combination of these techniques into practice that is customized to the particular pest pressures in a given setting. A comprehensive and diversified strategy is needed to control insect pests in the marigold growth process. Growers can enjoy healthy, bright marigold displays while minimizing the environmental impact of pest management procedures by integrating a variety of control strategies and giving ecologically friendly techniques priority

    Prevalence of Bacteria Associated with Mobile Phones of Inpatients in Some Hospitals in Ardo-Kola Metropolis, Nigeria

    Get PDF
    Mobile phones are carried everywhere thus coming in contact with various surfaces. Inpatients' mobile phones may contain potential nosocomial causing microbes to the inpatient, family members, and the general public. Thirty-two (32) inpatient phones were chosen at random from three study areas to see if they could function as formites and contain bacteria that could be transferred. First Referral Hospital Sunkani, Primary Healthcare Kofai and Lafiya clinic ATC) in Ardo Kola Local Government, Taraba State were the study area. The goal of this study was to determine the prevalence of bacterial contamination on inpatients' phones and to identify bacterial isolates. A swab sample from each inpatient's phone (using a moist sterile swab), as well as a self-administered questionnaire, was retrieved. Samples were cultured in nutrient, blood and macConkey’s agar using the streak method, bacteria were identified using Gram staining and a few biochemical assays (indole, citrate utilization, catalase, oxidase, coagulase, and urease test). The overall prevalence of mobile phone contamination with one or more bacteria was 90.6 percent, with the most common bacteria isolates being Staphylococcus aureus (46.9%) and Escherichia coli (34.4%), and the least common bacteria isolates being Klebsiella spp. (12.5%) and Enterococcus spp. (12.5%). As a result, using various methods to control the growth of bacteria, such as restricting mobile phone use in hospitals and implementation of proper hand washing hygiene, is necessary to shed bacterial burden and reduce contamination

    105

    full texts

    115

    metadata records
    Updated in last 30 days.
    Asian Journal of Research in Biosciences
    Access Repository Dashboard
    Do you manage Open Research Online? Become a CORE Member to access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard! 👇