Journal of Tropical Pharmacy and Chemistry
Not a member yet
317 research outputs found
Sort by
Activity of Tokulo (Kleinhovia hospita L.) as Anti Rheumatoid Arthritis and Anti-inflammatory in White Rats Induced by Complete Freud Adjuvant (CFA)
Get PDFTokulo (Kleinhovia hospita) leaves are commonly used by Moronene people (Southeast Sulawesi) to treat headaches. This is supported scientifically from research which states that tokulo leaves have analgesic and anti-inflammatory activity. The NSAID group is included in the anti-rheumatoid arthritis therapy. To determine the anti-RA activity of this plant, a study was carried out on CFA-induced rats. Based on the results of the study, it is known that the ethanol extract of tokulo leaves has anti-RA and anti-inflammatory activity in CFA-induced rats. Keywords: Kleinhovia hospita, Rheumatoid Arthritis, Inflammatio
Primer Design and Analysis for Detection of mecA gene
Get PDFMecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ?3, stability ?1,2, secondary structure >-16 Kcal/mol, runs ?5, repeats ?4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC\u273), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC\u273), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR metho
A Phytopharmacological Review on a Medicinal Plant: Cordia africana Lam.
Get PDFThe use of phytoconstituents single or combined with standard medicines has been utilized in cure of different diseases. Many plants of genus Cordia comprise of trees and shrubs are widely distributed in warmer regions and have been utilized in management of various diseases. Cordia africana Lam. (family- Boraginaceae) is a small to medium-sized evergreen tree, 4 to 15 (30) m high, heavily branched with a spreading, umbrella-shaped or rounded crown. Bole typically curved or crooked. Bark grayish-brown to dark brown, smooth in young trees, but soon becoming rough and longitudinally fissured with age; young branch lets with sparse long. Uses of C. africana: firewood, timber (furniture, beehives, boxes, mortars, church, drums), food (fruit), medicine (bark, roots), fodder (leaves), bee forage, mulch, soil conservation, ornamental, shade. Various phytoconstituents like flavonoids, alkaloids, tannins, terpenoids, saponins, steroids, anthraquinones, carbohydrates and protins having different activities were screened and isolated from different parts of Cordia africana. Various important Pharmacological properties including Antioxidant, Cytotoxicity, anti-inflammatory, anthelmintic, antimicrobial, anti-nociceptive, and others have been well documented for this plant. Therefore, we have briefly reviewed the various bioactivities of Cordia africana to improve our knowledge on plant phytochemicals as therapeutic entities. The present review describes the various phytoconstituents and therapeutic potential of Cordia africana that can be followed for future research on this plant for human health benefits
Antibacterial Activity of Salam (Syzygium polyanthum) Leaves 70% Ethanolic Extract on Staphylococcus aureus and Staphylococcus epidermidis
Get PDFIndonesia has a high diversity of potential medicinal plants, which are the second-largest number of indigenous medicinal plants in the world. Syzygium polyanthum, known as Indonesian Bay Leaf or Salam, easily found, widely used in Indonesia as a spice in cooking and traditional medicine. Salam contains secondary metabolites such as flavonoids, alkaloids, tannins, essential oils, sesquiterpenes, triterpenes, phenols, steroids, and saponins. Staphylococcus aureus and Staphylococcus epidermidis are the main bacteria that cause commensal infection and the most common nosocomial infections. This study aims to know the antibacterial activity of the Salam ethanolic extract against Staphylococcus aureusand Staphylococcus epidermidis bacteria. Salam leaves were extracted by 70% ethanol in the maceration method. Antibacterial activity was conducted by the disk diffusion method. The extract exhibits moderate activity (10.51±0.3 mm) at 75% of concentration and low activity (3.69±0.4 mm) at 100% of concentration against Staphylococcus aureus and Staphylococcus epidermidis respectively. The test showed that salam leaves extract had antibacterial activity against Staphylococcus aureus and Staphylococcus epidermidis
Antioxidants Activity of Self-Nanoemulsifying Drug Delivery System on Dayak Onions Extract (Eleutherine palmifolia) using DPPH (2,2 difenil-1- picrylhydrazyl) Method
Get PDFDayak onions (Eleutherine palmifolia L. Merr) is one plant that has been proven to have benefits as an antioxidant. The Dayak extract is formulated in the self nano emulsifying drug delivery system (SNEDDS) because the extract has low water solubility. The aims this study to develop the SNEDDS formulation system by testing its antioxidant activity. We determined whether there was an increase in antioxidant activity when formulated in the form of SNEDDS or not. The results were then compared with a solution of Dayak onions extract without using SNEDDS. The obtained formula was the optimal result that has been done before using the D-optimal mixture design method. The results of the components consisted of 50 mg of Dayak extract, 10 % caprylic triglyceride as oil, 1% tween 80, and 6,60 % transcutol as a combination surfactant and 12,40 % propylene glycol as co-surfactant. Antioxidant activity testing was carried out using the DPPH (1,1-Diphenyl-2-picrylhydrazyl) method. The antioxidant test using the DPPH method was done with two samples, namely the extract solution and Dayak onion extract SNEDDS. We elaborated the research by using UV-VIS spectrophotometer. Each sample was made into five concentrations, namely 30 ppm, 60 ppm, 90 ppm, 120 ppm, and 150 ppm, and carried out three times replications. The results showed that the IC50 value in the Dayak onion extract solution was 227,19 ppm (very low), while for the SNEDDS solution for the Dayak onion extract the IC50 value obtained was 38,97 ppm (very strong). The analysis was carried out next using an independent T-Test to obtain the results. There was no significant difference between the extract solution and the SNEDDS solution of Dayak onion extract
Leaf Extract Microencapsulation of Stevia rebaudiana Bert Using Inulin-Chitosan as Anti-Diabetes Diet
Get PDFDiabetes mellitus is a collection of symptoms that arise in someone who has increased blood glucose levels. The Stevia plant (Stevia rebaudiana Bert) contains a compound of diterpene glycosides as steviosida and rebaudiosida A. Purified extract of steviosida and rebaudiosida A is widely used as a sweetener for low calorie food and beverage products or as a sugar substitute for diabetics and has the effect of lowering blood sugar levels. This study aims to determine the antidiabetic effect of microencapsulated preparations of Stevia leaf extract (Stevia rebaudiana) with a combination of inulin chitosan encapsulation. Antidiabetic mellitus test was carried out in vivo using test animals of male white rats of Wistar strain. The inducing compound that can cause the condition of diabetes mellitus test animals is Aloxan with a dose of 150 mg / kg Body weight of rats. given intraperitoneally for one day, then the mice were allowed to stand for 3 days to reach a state of diabetes mellitus. Blood glucose levels of test animals were measured on days 1 (initial), 5 (induction) and 12 (treatment) to determine the initial blood glucose levels, after induction of alloxan and after administration of test compounds both CMC Na 0.5% , glibenclamide, and preparations microencapsulation of Stevia leaf extract at a dose of 100; 300; and 700 mg / kg body weight. The results were obtained after 7 days of treatment, it was seen that blood glucose levels in the CMC group remained high, while the Glibenclamid administration group, and the three dosages of microencapsulation preparations of Stevia leaf extract could reduce blood glucose levels. This can be seen from the statistical test that there is a significant difference (p <0.05) between the CMC group and the Glibenclamide group, and microencapsulation preparations of Stevia leaf extract. Microencapsulation preparations of Stevia leaf extract can reduce blood glucose levels with an effective dose of 100 mg / kg body weight
Proximate Composition, In vitro Antioxidant and Anti-inflammatory Properties of Adansonia digitata and Belanites aegyptiaca Seeds
Get PDFThis study evaluated the nutritional and medicinal properties of seeds from Adansonia digitata (BSF) and Balanite aegyptiaca (DDSF) plant. Proximate chemical composition, mineral elements composition, flavonoids, phenolics, antioxidant capacity, and anti-inflammatory properties were studied. Results obtained revealed that DDSF had the highest moisture, crude fat and crude protein content of 7.66 %, 42.80 %, 20.37 % respectively, whilst BSF gave the highest ash, crude fibre and carbohydrate content. Elemental analysis revealed BSF had the highest Mg content (313.65 mg/100g) and DDSF gave the highest Ca content (118.62 mg/100g). Additionally, DDSF gave the highest total phenolics (18.89 mg TAE/ 100 g), total flavonoids (8.80 mg QE/ 100 g) as well as the highest total antioxidant capacity of (19.62 mg AAE/ 100 g) dry of extract. Based on results obtained in this study, seeds obtained from the Adansonia digitata and Balanite aegyptiaca could be a potential source of functional food and antioxidant agents
Physical Evaluation of Transfersome that Contains Pandan Leaves Extract (Pandanus amaryllifolius R.)
Get PDFPandan leaves have been researched and have effectiveness in the treatment of burns. The process of healing burns takes a long time and cause a hard tissue because it loses its elasticity, making it difficult to penetrate. In this study, pandanus leaves were formulated into the nanovesicle carrier system, namely trasfersom. Transfersomes have the ability to deform, namely the ability to reduce the particle size 5-10 times from the original size when passing through the gaps between cells so that transfersom can increase the penetration of active substances. The three formulas used are based on the ratio of concentrations of trasfersome vesicles, namely phospholipids and span 80. Formula 1 is (90:10), Formula 2 (85:15) and Formula 3 (80:20). The best formula is determined based on transfersom characterization, including particle size and PDI (solidispersity index), zeta potential, entrapment efficiency, deformability, and TEM particle morphology. The results showed that Formula 3 (80:20) is the most stable formula with an average particle size of 730.1 ± 4.9 nm, PDI value <0.7, zeta potential - 9.94 ± 1.02 mV, efficiency absorption 80.23%, and the deformability value 6.225
Identification and Determination of Berberine from Arcangelisia Flava, East Borneo
Get PDFBerberine is a compound that has various benefits but also has dangerous toxic effects. In Indonesia, the Regulation of the Head of the Food and Drug Supervisory Agency No. 10 of 2014 concerning the Prohibition of Producing and Circulating Traditional Medicines and Health Supplements Containing Coptis Sp, Berberis Sp, Mahonia Sp, Chelidonium Majus, Phellodendron Sp, Arcangelica Flava, Tinosporae Radix, and Catharanthus Roseus. Regulation No. 7 of 2018 (BPOM, 2018) also prohibits the presence of berberine in processed food. This research was conducted to determine the content of berberine compounds from the extract and stem fraction of Arcangelisia flava. The research was conducted by identifying the content of berberine by TLC method compared with Rf Berberine sulfate and determination of berberine content by HPLC method (High-Performance Liquid Chromatography) using column C-18 (ODS). Berberine content of methanol extract, n-hexane fraction, ethyl acetate fraction and Arcangelisia Flava methanol-water fraction were 0.0040, respectively; 0.0010; 0.0041, 0.0044%
Relationship of Knowledge on Respiratory Disorders with Lung Function in Masons in East Surabaya
Get PDFMasons are regularly exposed to air pollution in the workplace The pollution exposure received by them is a risk factor for respiratory problems. Most of the masons had insufficient knowledge that is very important for the management of a person\u27s illness. The purpose of this study was to determine relationship of knowledge on respiratory disorders with lung function in masons in east surabaya. This research was an observational study with a cross-sectional design with a purposive method.The research was conducted from April to July 2019 in the East Surabaya area. The variables that will be observed in this study are the level of knowledge of risk factors, symptoms, and treatment and therapy regarding respiratory disorders. In this study, there were 158 respondents consisting of 79 groups with impaired lung function and 79 groups without lung function disorders. Most of the level of knowledge of both groups was good in risk factors and treatment of respiratory disease, but instead on the symptoms regarding respiratory disease. The research showed that there was a relationship between the level of knowledge about risk factors for respiratory disease (p(0.223)<0.05) and lung function, but there was no difference in knowledge about symptoms (p(0.745)<0.05) and treatment (p(0.741)<0.05) respiratory disease with pulmonary function. Therefore, it was necessary to plan further educational programs in increasing masons\u27 knowledge of respiratory symptoms so that they could catch respiratory diseases earlier