Jurnal FKIP Universitas Mataram (Fakultas Keguruan Dan Ilmu Pendidikan)
Not a member yet
    4991 research outputs found

    Efektivitas Efektivitas Media Pembelajaran Augmented Reality Materi Bangun Ruang Sisi Datar di SMPN 1 Gunungsari

    No full text
    This study aims to determine the effectiveness of Augmented Reality (AR)-based learning media on students' mathematics learning outcomes of flat-sided space building material. This research uses a quasi-experiment method with a non-equivalent control group design. The subjects of this study were VII grade students of SMP Negeri 1 Gunungsari as many as two classes, namely the experimental class and the control class. Where the experimental class is given Augmented Reality-based learning media while the control class is given website-based learning media. This study was conducted for 5 meetings, starting with giving a pretest, followed by learning by implementing learning media for 3 meetings in each class and giving a questionnaire of learning interest for the experimental class. The last meeting was held posttest to determine student learning outcomes. Data analysis used independent sample t-test and N-Gain Mean analysis. The results showed that AR media was significantly effective in improving students' math learning outcomes (P < 0.005), with the N-Gain category of the experimental class classified as high and effective, while the control class was categorized as less effective. In addition, the use of AR media also increases students' interest in learning, with a very good category.Abstrak Penelitian ini bertujuan untuk mengetahui efektivitas media pembelajaran berbasis Augmented Reality (AR) terhadap hasil belajar matematika siswa materi bangun ruang sisi datar. Penelitian ini menggunakan metode quasi-eksperimen dengan desain non-equivalent control group design. Subjek penelitian ini adalah siswa kelas VII SMP Negeri 1 Gunungsari sebanyak dua kelas, yaitu kelas eksperimen dan kelas kontrol. Diamana kelas eksperimen diberikan media pembelajaran berbasis Augmented Reality sedangkan kelas control diberikan media pembelajaran berbasis website. Penelitian ini dilaksanakan selama 5 pertemuan, dimulai dengan memberikan pretest, dilanjutkan dengan pembelajaran dengan mengimplementasikan media pembelajaran selama 3 pertemuan pada setiap kelasnya dan pemberian angket minat belajar untuk kelas eksperimen. Pertemuan terakhir dilaksanakan posttest untuk mengetahui hasil belajar siswa. Analisis data menggunakan independent sample t-test dan analisis N-Gain Mean. Hasil penelitian menunjukkan media AR efektif secara signifikan dalam meningkatkan hasil belajar matematika siswa (P< 0,005), dengan kategori N-Gain kelas eksperimen tergolong tinggi dan efektif, sedangkan pada kelas kontrol terkategori  kurang efektif. Selain itu, penggunaan media AR juga meningkatkan minat belajar siswa, dengan kategori sangat baik. Kata Kunci: Augmented reality, bangun ruang sisi datar, hasil belajar, minat belajar, pendidikan matematik

    Pengaruh Model Pembelajaran Discovery Learning Terhadap Hasil Belajar dan Motivasi Belajar Kimia Siswa

    Get PDF
    The discovery learning model is a discovery-based learning model that is needed to improve learning outcomes and student learning motivation, especially in chemistry subjects which are synonymous with calculating theories, concepts, laws and facts. This research aims to describe the influence of the Discovery Learning learning model on learning outcomes and chemistry learning motivation for class XI students at SMAN 6 Mataram. This research is quantitative research with a quasi-experimental method (Quasi Experimental Design). The results of the research show that there is an influence of the Discovery Learning learning model on student learning outcomes in chemistry subjects. This can be seen from the results of hypothesis testing with the t-test at a significance level of 5%. The calculated significance was lower than 0.05, namely 0.008 < 0.05. In learning motivation, there is also an influence of the Discovery Learning learning model on students' learning motivation in chemistry subjects, which can be seen from the results of hypothesis testing with a t-test with a significance level of 5%. The calculated significance was lower than 0.05, namely 0.01 < 0.05.Model pembelajaran discovery learning merupakan model pembelajaran berbasis pnemuan yang diperlukan untuk meningkatkan hasil belajar dan motivsi belajar siswa khususnya pada mata pelajaran kimia yang identic dengan hitung-hitungan teori, konsep, hokum dan fakta. Penelitian ini bertujuan untuk mendeskripsikan pengaruh model pembelajaran Discovery Learning terhadap hasil belajar dan motivasi belajar kimia siswa kelas XI SMAN 6 Mataram. Penelitian ini merupakan penelitian kuantitatif dengan metode eksperimen semu (Quasi Experimental Design). Hasil penelitian menunjukkan terdapat pengaruh model pembelajaran Discovery Learning terhadap hasil belajar siswa pada mata pelajaran kimia. Hal tersebut dapat dilihat dari hasil uji hipotesis dengan t-test pada taraf signifikansi 5%. Diperoleh signifikansi hitung lebih rendah dari 0,05 yaitu 0,008 < 0,05. Pada motivasi belajar juga terdapat pengaruh model pembelajaran Discovery Learning terhadap motivasi belajar siswa pada mata pelajaran kimia yang dilihat dari hasil uji hipotesis dengan t-test dengan taraf signifikansi 5%. Diperoleh signifikasi hitung lebih rendah dari 0,05 yaitu 0,01 < 0,05. 

    Efektivitas Model Pembelajaran Terhadap Hasil Belajar Siswa Kelas XI pada Materi Laju Reaki

    No full text
    Research has been conducted on the effectiveness of Problem Based Learning model on the learning outcomes of Class XI students of SMAN 3 Sampolawa on reaction rate material. This study aims to determine the effectiveness of Problem Based Learning model on student learning outcomes on reaction rate material. The subjects in this study were 25 students of class XI MIPA 1. This type of research is pre-experiment with One Group Pretest-Posttest design. The research instruments included a learning outcome test consisting of 20 multiple choice questions and an observation sheet. The results showed that the average pretest score of 29.6 increased to 77.2 in the posttest. The effectiveness of learning based on the N-Gain value of 0.68 is included in the medium category, so the Problem Based Learning model is declared effective in improving student learning outcomes. Students' responses to the learning model were classified as very good, while the implementation of learning by teachers and students was considered good and experienced an increase. Keywords: Effectiveness, Problem Based Learning, Learning Outcomes, Reaction RateTelah dilakukan penelitian efektivitas model pembelajaran Problem Based Learning terhadap hasil belajar siswa Kelas XI SMAN 3 Sampolawa pada materi laju reaksi. Penelitian ini bertujuan  untuk mengetahui efektivitas model pembelajaran Problem Based Learning terhadap hasil belajar siswa pada materi laju reaksi. Subjek dalam penelitian ini adalah siswa kelas XI MIPA 1 sebanyak 25 orang. Jenis penelitian ini adalah pre-eksperimen dengan desain One Group Pretest-Posttest. Instrumen penelitian meliputi tes hasil belajar yang terdiri atas 20 butir soal pilihan ganda serta lembar observasi. Hasil penelitian ini menunjukkan bahwa nilai rata-rata pretest sebesar 29,6 meningkat menjadi 77,2 pada posttest. Efektivitas pembelajaran berdasarkan nilai N-Gain sebesar 0,68 termasuk dalam kategori sedang, sehingga model Problem Based Learning dinyatakan efektif dalam meningkatkan hasil belajar siswa. Respons siswa terhadap model pembelajaran tersebut tergolong sangat baik, sedangkan keterlaksanaan pembelajaran oleh guru dan siswa dinilai baik serta mengalami peningkatan. Kata Kunci: Efektivitas, Problem Based Learning, Laju Reaks

    IDENTIFIKASI PERKEMBANGAN KOGNITIF PADA ANAK KELOMPOK B DI GUGUS III RA KECAMATAN NARMADA

    Get PDF
    Penelitian ini bertujuan untuk mengetahui pencapaian perkembangan kognitif anak kelompok B di Gugus III RA Kecamatan Narmada. Jenis penelitian yang digunakan melalui pendekatan Deskriptif Kuantitatif dengan metode Survei. Sampel dalam penelitian ini adalah 80 orang anak terdiri dari 8 sekolah yang dipilih menggunakan pendekatan stratified proporsional random sampling. Teknik pengumpulan data dilakukan dengan cara observasi, wawancara dan dokumentasi. Metode analisis data yang digunakan dalam penelitian ini adalah analisis statistik deskriptif. Hasil penelitian ini memperoleh bahwa perkembangan kognitif pada aspek Belajar dan Pemecahan Masalah memiliki hasil 61.50% , untuk indikator Berpikir Logis memiliki hasil 60.25% dan indikator Berpikir simbolik memiliki hasil 58.50% .Pengujian persentase rata-rata pada penelitian ini menggunakan rumus P= F/N 100%. Maka ditarik kesimpulan bahwa dari aspek ketiga yang telah diteliti ini termasuk dalam kategori Mulai Berkembang yang berarti guru di sekolah secara belum optimal dalam mencapai pencapaian perkembangan kognitif anak di kelompok B

    Agreement of Non-Contact Infrared Thermometer Measurement Results with Digital Axillary Thermometer in Neonates at the Pejeruk Community Health

    Get PDF
    NCIT has several advantages, such as quick measurement time, no need for contact between the device and the patient, and greater comfort for patients compared to measuring temperature using TDA or rectal digital thermometers. These advantages make NCIT suitable for use in PKM. However, previous research on the comparability of NCIT measurement results with TDA in neonates is limited and shows varying results. This study aims to determine the agreement of NCIT measurement results with TDA measurement results in neonates. The study is an analytical observational study with a cross-sectional design. 25 neonates participated in this study, with some having their temperature measured only once and others more than once, according to an agreement with their guardians. A total of 62 temperature measurement samples were taken after going through the inclusion and exclusion process. The measuring instrument used was the digital axillary thermometer (TDA), which served as the reference. Additionally, three types of non-contact infrared thermometers (NCITs) were used to assess their agreement for this study. The sample data was analyzed using the One-Sample T-test, Intraclass Correlation Coefficient (ICC) method, and Bland Altman Plot. The ICC results indicated poor agreement of each NCIT with the TDA. The One Sample T-test indicates that of of the NCIT used does not have statistically significant differences compared to TDA, whereas two other types of NCIT do have statistically significant differences compared to TDA, The Bland Altman Plot analysis shows that the Limits of Agreement for each type of NCIT with TDA are still wide. From these results, it is concluded that these three types of NCIT cannot replace TDA as a body temperature measurement tool for neonates

    Formulation of Castor Leaf Extract as a Propestic Pesticide to Control Shallot Caterpillar Pest Spodoptera Exigua Hubn

    Get PDF
    One of the crops that can be cultivated in drylands is shallots. Spodoptera exigua Hubn is the main pest that attacks shallot plants. The purpose of writing this article is to review the results of previous research on jatropha leaves as a vegetable peticide with various extracts so that it can be known which extract is the most optimal as a control of onion caterpillar pests. The method used in this writing is to collect and process data sources from previous research published in scientific articles, books, and discussion results.  The results showed that active compounds such as saponins, flavonoids, alkaloids, tannins, and phenols in Jatropha leaves extract significantly increased pest mortality and decreased pest feeding activity. Higher  extract concentrations were directly proportional to greater negative effects on pests, highlighting the potential of falak nut leaves as an effective and environmentally friendly plant-based pesticide

    Organoleptic Test of Herbal Tea Made with Corn Silk (Zea Mays L.), Papaya Seeds (Carica papaya L.) and Dragon Fruit Peels (Hylocereus polyrhizus L.)

    Get PDF
    Tea (Camellia sinensis) is one of the most widely consumed beverages globally, valued for its economic, health, and cultural benefits. In Indonesia, abundant natural materials with antioxidant properties, such as dragon fruit peels, corn silk, and papaya seeds, are often discarded as waste. This study aimed to utilize these materials to create teatrasi herbal tea and evaluate its antioxidant and flavonoid content, sensory attributes, and overall acceptability. method and analysis the process involved material preparation, thorough washing, drying at specific temperatures and times, grinding, and packaging. Three formulations were tested, with Formula 3 (40% corn silk, 20% papaya seeds, and 40% dragon fruit peels) being the most favored based on hedonic tests. Antioxidant and flavonoid analyses confirmed strong antioxidant activity (IC50: 89.27 ppm) and high flavonoid content (884.64 mg/L QE) in Formula 3. Results organoleptic tests highlighted its distinctive corn silk aroma, reddish-brown color, and mild flavor. Respondents rated its aroma, color, and taste with favorability levels of 93.75%, 90.62%, and 92.70%, respectively, achieving an overall acceptance rate of 92.29%. Conclusion, this research demonstrates the potential of converting underutilized natural resources into sustainable, health-enhancing beverages

    Diversity of Bryophytes Based on Substrate Types in the Karangkamulyan Tourist Area, Ciamis Regency

    Get PDF
    Indonesia is renowned as a megabiodiversity country with a wealth of flora, including the diversity of bryophytes. These plants play a crucial role in ecosystems, such as oxygen production, erosion control, and water absorption. This study aims to analyze the diversity of bryophytes in the Karangkamulyan Tourism Area, Ciamis Regency, and to examine their diversity based on substrate types. Karangkamulyan is a cultural and natural conservation area covering 25.5 hectares with a climate and conditions that support bryophyte growth. The research utilized an exploratory method with random sampling at three selected points within the area. Morphological and anatomical analyses were conducted to identify species, and the percentage of occurrence was analyzed based on substrate types. The results revealed the presence of 15 species belonging to 12 families of bryophytes inhabiting various substrates such as soil, rocks, and tree trunks. The identified bryophytes included 6 liverworts (Marchantiophyta): Dumortiera hirsuta, Marchantia emarginata, Riccia gangetica, Heteroscyphus argutus, Heteroscyphus coalitus, and Schiffneriolejeunea sp.; and 9 mosses (Bryophyta): Neckeropsis undulata, Thuidium plumulosum, Ectropothecium falciforme, Fissidens sp., Fissidens flaccidus, Calymperes sp., Hyophila sp., Barbula sp., and Bryum sp. Based on substrate types, 91 occurrences were recorded, consisting of 25% terrestrial bryophytes (23 occurrences), 55% epiphytic bryophytes (50 occurrences), and 20% epilithic bryophytes (18 occurrences)

    Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program

    Get PDF
    The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST

    Literatur Review: Analysis of Essential Oil Secondary Metabolite Content in Several Plants

    Get PDF
    Indonesia’s rich plant biodiversity offers a wide array of secondary metabolites, including essential oils, known for their antioxidant, antifungal, and antibacterial properties. This review article examines the secondary metabolite composition of essential oils from various plant species by synthesizing findings from existing literature. The review article highlights the presence of diverse compounds, including terpenes, phenols, and alkaloids, with variations observed between species—for instance, limonin in citrus, linalool in ylang-ylang, and eugenol in cloves. Commonly utilized methodologies, such as steam distillation and GC-MS analysis, discuss their effectiveness in characterizing essential oil components. The findings underscore the extensive potential of crucial oils for applications in health, food, and cosmetic industries, providing a foundation for future research and practical innovations

    4,781

    full texts

    4,991

    metadata records
    Updated in last 30 days.
    Jurnal FKIP Universitas Mataram (Fakultas Keguruan Dan Ilmu Pendidikan)
    Access Repository Dashboard
    Do you manage Open Research Online? Become a CORE Member to access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard! 👇