Traektoria Nauki
Not a member yet
1424 research outputs found
Sort by
Effect of Corporate Governance Mechanisms on Going Concern Likelihood of Listed Deposit Money Banks in Nigeria
Going concern describes the company's ability to maintain its business continuity. The auditor can issue a going concern audit opinion if the company's condition is doubtful in its business continuity. Based on this premise, this study investigated the effect of corporate governance mechanisms on the going concern likelihood of Deposit Money Banks (DMBs) in Nigeria. The study used an ex post facto research design. The secondary data source was collected from the published annual financial reports of the studied DMBs in Nigeria. The study covered fifteen DMBs in Nigeria, ranging from 2013 to 2021. The data collected were analysed using logistic regression analysis using STATA software. Findings from the research show that board financial expertise and independence negatively and significantly affect the likelihood of DMBs in Nigeria. The study also indicates audit firms' size positively affects going concern likelihood. While audit tenure shows a negative and significant impact on the going concern likelihood of DMBs in Nigeria. Based on the above findings, the study recommends that the authorities ensure that the board has the requisite financial expertise to oversee the financial reporting, risk management, and decision-making of the DMB. The regulatory authorities should also investigate cases of perceived failure of the board to perform its oversight function and take appropriate disciplinary actions against erring board members
The Effectiveness of Using the Bantara Enforcement Scout Practical Guidebook in Increasing Material Understanding in Man Scout Participants in Aceh Besar, Indonesia
Scouting is an educational process outside the school environment and outside the family environment in the form of interesting, fun, healthy, organized, directed, practical activities carried out in the open with the basic principles of Scouting and Scouting Methods, which ultimately target the formation of character, morals and noble ethics. The Scout Movement at the State Aliyah Madrasah in Aceh Besar is a mandatory extracurricular activity that all students must follow. Still, in the implementation of daily training, there are various obstacles obtained, both in terms of basic scouting knowledge that is not yet in the knowledge and facilities and infrastructure that are not adequate, therefore the existence of the Bantara Enforcement Scout Practical Guidebook as a book that is used as a guideline for enforcement scouts in improving Understanding Scouting. The purpose of this study was to determine whether the Bantara Enforcement Scout Practical Handbook was effectively able to improve material understanding in scout participants. This type of research uses a qualitative approach with descriptive statistical research methods and a Quasi-Experiment Group Pretest-Posttest research design. Based on the results of the data obtained that there is an increase in understanding of the material in scout participants. It can be seen from the results of the pre-test 68.71 and post-test 94.24 with signs. Based on pre-test and post-test scores, the N-Gain Score is 0.8303, which means that the Scout Practical Handbook High Bantara Enforcers have high effectiveness in increasing the understanding of the material of scout participants. The implications of the Bantara Scout Enforcer Practical Handbook can effectively assist scouts independently and with coaches in improving the ability of general scouting standards and specific scouting standards that Bantara enforcement scouts must have
Awareness and Implications of Aircraft Noise on the Airport Staff of Mallam Aminu Kano International Airport Kano, Nigeria
Noise pollution, operationally defined as 'unwanted sound', has become an environmental contaminant of massive proportions. Noise causes annoyance, frustration, impediment to learning, and general stress. Of all present-day sources of noise, the noise from surface transportation, above all that from road vehicles, is the most diffused and difficult to control. Aircraft, industrial noise, noisy neighbours, and their pets are other familiar sources of noise aggravation. Noise pollution is a harmful environmental impact of sound, which, by its nature, volume, or duration, is likely to have health effects.This research aims to measure the noise level within the Mallam Aminu Kano International Airport, examine the effects of aircraft noise on employees, assess the awareness level of workers on the impact of aircraft noise, and determine the level of compliance with safety standards.This study examined the implications and awareness of aircraft noise at the Mallam Aminu Kano International Airport (MAKIA). The noise level within the five selected locations was measured. A noise meter was used to measure the noise at the new fire station, old fire station, international terminal building, domestic terminal building, and main apron. Primary and secondary data were used; fifty questionnaires were randomly distributed to staff from the fire department, aviation security, ground handlers of the Nigerian Aviation Handling Company (NAHCO) and Skyway Aviation Handling Company Plc (SAHCO), airfield staff of the operations department, and airliners. The data obtained from the noise meter were analyzed using the mean noise level, whereas descriptive statistics and simple percentages were used to analyze the data obtained from the questionnaire.The level of staff awareness of aircraft noise implications due to prolonged exposure and safety regulations was determined. The noise produced within the study area is between 65 and 98 decibels. Seventy-four percent of the responders think that aircraft noise is a nuisance, with more than 50% aware of the implications of noise exposure. In contrast, only 24% have experienced some of the effects of aircraft noise, such as headache, cardiovascular loss, and hearing loss. It was discovered that employers are not providing enough safety kits for their employees, and most staff do not undergo safety training and are not aware of any laws regulating noise. In conclusion, staff need training on noise pollution, its effects, and ways to reduce health implications
Analysis of Farmers' Response and Suitability of Innovation to the Use of Coffee Processing Units in Post-Couplet Equipment Central Lombok District, Indonesia
This research aims to know the response of farmers to the application of postharvest tools for coffee processing units in Central Lombok Regency, see the level of suitability of coffee processing technology as an innovation in farmer groups/farmers in Central Lombok Regency and know the relationship between the suitability of innovation and farmer responses to the use of postharvest coffee tools in Central Lombok Regency. The research results show that the reaction of farmers to the use of postharvest equipment for coffee processing units is in the "Good" category or knowing but not in detail, as evidenced by the acquisition of a combined mode score of 105 from an interval score of 89-109 obtained from the overall measurement results through indicators of knowledge (cognitive aspect), attitude (affective aspect) and ability to apply (psychomotor aspect). With the assessment results in the "Good" category, respondents have knowledge, attitudes, and skills with good understanding and ability but do not have detailed knowledge of postharvest coffee processing tools. These factors support in terms of education, human resources, communication, experience in farming and especially the needs of farmers in improving socio-economic conditions with modern innovations as a substitute for traditional methods, namely as one of the efforts that are expected to achieve increased added value and competitiveness and farmers' income through proper and correct postharvest handling. From a non-technical perspective, covering socio-economic and socio-cultural aspects, respondents felt a positive influence. Still, from a socio-cultural perspective, the community felt the direct and indirect impacts as positive things, including increasing the economy in their environment. Still, there are also adverse effects, namely the noise of machines due to modern processing methods and air pollution, which can interfere with breathing. There is a relationship between farmers' responses and the suitability of innovation in their use of postharvest equipment for coffee processing units, seen from the value of rs = 0,949, which is included in the robust category and has a positive value, namely the higher the farmer's response to the use of the postharvest equipment for the coffee processing unit, the higher the suitability of the innovation of the postharvest tool for the coffee processing unit in the government assistance program in Central Lombok Regency. On the other hand, the lower the response of farmers to the use of postharvest equipment for coffee processing units, the lower the suitability of innovations for postharvest equipment for coffee processing units in government assistance programs in Central Lombok Regency
Implementation of Academic Supervision by the School Principle in SMP Negeri 2 Kuripan, West Lombok District, Indonesia
Supervision is an activity to assist teachers in developing their abilities and skills in managing to learn and achieving learning objectives. This research focuses on the implementation of academic supervision by the principal at SMP Negeri 2 Kuripan, West Lombok Regency. This study aimed to describe the planning, implementation and follow-up of academic supervision by the principal at SMP Negeri 2 Kuripan, West Lombok Regency. This research uses a qualitative approach with a case study method. Data collection is done through observation, interviews and documentation. The research subjects were school principals and teachers at SMP Negeri 2 Kuripan. Supervision techniques used are individual techniques and group techniques. The results showed that: 1) school principals have good supervision planning, namely carrying out preparatory meetings, forming teams, preparing supervision program plans, and preparing supervision schedules. 2) School principals carry out academic supervision with pre-observation, observation, and post-observation or feedback meetings. 3) the principal carries out follow-up academic supervision, provides reinforcement and appreciation to teachers who meet standards, gives reprimands, advises teachers who do not meet standards, and provides opportunities for teachers to follow further education and training
Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis
Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5’AACAGACGGGTAGTCATGATTGAG3’ R5’GTATCTGATCGTCTTCACTCCC3’. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy
The Study on Dialogic Discourse
The article discusses the features and approaches to dialogic speech analysis. Through the analysis of dialogic discourse, new opportunities arise for studying human existence. Since the second half of the XX century, interest in interpersonal communication, dialogic discourse, and conversation analysis has significantlyincreased. The growing importance of communication in society is noted in modern humanities. Therefore, dialogue as an "ideal type" of communication and issues related to its characteristics are of particular importance in contemporary linguistics. Due to the study of dialogic discourse, new opportunities arise for studying man, his role in society, and social communication. The realisation of dialogues characterises the characteristics of thinking. Communication problems are multifaceted and express people's culture and thoughts. The issue of defining the conceptual and semantic meaning of dialogue as a basic concept of dialogue discourse is evident and necessary
Performance Evaluation of Tamarindus Indica Seeds Powder in the Treatment of Dye Wastewater
A large amount of dye wastewater is generated after the local dyeing process. It contains high concentrations of organic and inorganic contaminants. Furthermore, the composition of the wastewater varies according to the type and number of textiles and the water requirements of the process. Hence, its treatment before discharge is necessary to protect the environment. This study investigated the use and effectiveness of Tamarindus indica seeds powder from agricultural waste for removing some recalcitrant target compounds in the dye wastewater. A batch test was performed to examine the use of this adsorbent as a potential replacement for the advanced treatment methods. Varying adsorbent dosages determined the maximum adsorption capacity at 30, 35, 40, 45, and 50 g and at 24, 48, 72, 96 and 120 hr reaction times. The optimum dosage, reaction time and percentage removal of various parameters were found to be; Turbidity (no significant effect), TDS (40 g/l, 72 hrs, 54.42%), EC (35 g/l, 72 hrs, 4.46%), Phosphate (35 g/l, 24 hrs, 38.49 %), Total suspended solid (no significant effect), Nitrate (30 g/l, 96 hrs, 15.26%), COD (no considerable impact) and BOD (30 g/l, 48 hrs, 63.38%) respectively. The results showed that adsorption efficiency increased with decreased adsorbent dosage, even at different reaction times. Hence, low-cost adsorbents such as Tamarindus indica seeds can treat dye waste water to a certain level for safe disposal
Principles for Teaching Economics and Social Science Education Discourse
The research employed critical discourse analysis of official social science documents and three prominent lines of social science textbooks. Despite the recent emphasis on incorporating real-world economic practices into school financial education, the findings reveal that new social science textbooks exhibit increased criticism toward the market economy. Furthermore, they tend to avoid addressing and analysing the socio-economic issues of the present day. The study concludes by emphasising the need for economic education in schools to focus on contemporary social and financial problems.
Analysis of Financing at Bank Muamalat Indonesia Branch Mataram, Indonesia
This study examines and analyses the implementation of musyarakah, mudharabah and murabahah financing and the obstacles in implementing such financing at Bank Muamalat Indonesia Mataram Branch. The type of research used is normative empirical using statutory, sociological and conceptual approach methods. Types and sources of data are carried out using primary and secondary legal materials and field data. Based on the research results, it is known that implementing musyarakah, mudharabah and murabahah financing at Bank Muamalat Indonesia Mataram Branch from the perspective of Islamic law has yet to be appropriate in several aspects. The obstacles in funding come from two factors, namely external and internal