1,721,022 research outputs found
FIGURE 5 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
No full textFIGURE 5. Putative secondary structures of the 22 tRNA genes of the Smerinthus planus mitochondrial genome.Published as part of Wu, Lingling, Jiang, Xiaoli, Xie, Fengjiao, Kausar, Saima, Liang, Dan, Wei, Guoqing, Zhu, Baojian, Wang, Lei, Liu, Chaoliang & Qian, Cen, 2020, The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species, pp. 533-552 in Zootaxa 4821 (3) on page 542, DOI: 10.11646/zootaxa.4821.3.6, http://zenodo.org/record/440109
Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica
No full textSong, Zhijun, Yao, Caiyun, Wang, Shuo, Yan, Bingxiong, Wu, Yunqiu, Song, Shanshan, Liu, Xihui, Wu, Lingling, Gong, Xiaomei, He, Lili, He, Zhizhou, Ruan, Lijun, Miao, Jianhua (2021): Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica. Phytochemistry (112659) 184: 1-8, DOI: 10.1016/j.phytochem.2021.112659, URL: http://dx.doi.org/10.1016/j.phytochem.2021.11265
Fig. 3 in Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica
No full textFig. 3. Key NOESY correlations of compounds 1–7.Published as part of Song, Zhijun, Yao, Caiyun, Wang, Shuo, Yan, Bingxiong, Wu, Yunqiu, Song, Shanshan, Liu, Xihui, Wu, Lingling, Gong, Xiaomei, He, Lili, He, Zhizhou, Ruan, Lijun & Miao, Jianhua, 2021, Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica, pp. 1-8 in Phytochemistry (112659) 184 on page 4, DOI: 10.1016/j.phytochem.2021.112659, http://zenodo.org/record/829222
FIGURE 9 in The RNA-seq approach to discriminate gene expression profiles in response to Beauveria bassiana and Micrococcus luteus microbial pathogens on Actias selene (Lepidoptera: Saturniidae)
No full textFIGURE 9. Larva and adult of Actias selene.Published as part of Liang, Dan, Wang, Pei, Wu, Lingling, Jiang, Xiaoli, Wei, Guoqing, Zhu, Aojian, Wang, Lei, Zhang, Heyu, Toufeeq, Shahzad, Qian, Cen & Liu, Chaoliang, 2019, The RNA-seq approach to discriminate gene expression profiles in response to Beauveria bassiana and Micrococcus luteus microbial pathogens on Actias selene (Lepidoptera: Saturniidae), pp. 1-71 in Zootaxa 4591 (1) on page 14, DOI: 10.11646/zootaxa.4591.1.1, http://zenodo.org/record/265694
Fig. 1 in Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica
No full textFig. 1. Chemical structures of the compounds isolated from Blumea aromatica (1–7).Published as part of Song, Zhijun, Yao, Caiyun, Wang, Shuo, Yan, Bingxiong, Wu, Yunqiu, Song, Shanshan, Liu, Xihui, Wu, Lingling, Gong, Xiaomei, He, Lili, He, Zhizhou, Ruan, Lijun & Miao, Jianhua, 2021, Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica, pp. 1-8 in Phytochemistry (112659) 184 on page 2, DOI: 10.1016/j.phytochem.2021.112659, http://zenodo.org/record/829222
Fig. 6 in Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica
No full textFig. 6. Experimental electronic circular dichroism (ECD) spectra of 1 and 3–6.Published as part of Song, Zhijun, Yao, Caiyun, Wang, Shuo, Yan, Bingxiong, Wu, Yunqiu, Song, Shanshan, Liu, Xihui, Wu, Lingling, Gong, Xiaomei, He, Lili, He, Zhizhou, Ruan, Lijun & Miao, Jianhua, 2021, Aromatin D-J: Seven previously undescribed labdane diterpenoids isolated from Blumea aromatica, pp. 1-8 in Phytochemistry (112659) 184 on page 6, DOI: 10.1016/j.phytochem.2021.112659, http://zenodo.org/record/829222
FIGURE 6 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
No full textFIGURE 6. Sequence alignment of PCG and tRNA regions from 27 different Lepidoptera species. 6A, The color sequence part is motif AAGATAGAAACCAACCTGGCTYACACCGGTTTGAACTCAGATCATGTAAG; 6B, The color sequence part is motif GAAGAATGAACTAAAGCAGAAACWGGAGTWGGAGCWGCTATAGCWGCWGG; 6C, The color sequence part is motif AAYCCWGAAACTAATTCTCTTTCHCCTTCAGCAAAATCAAAAGGAGTWCG.Published as part of Wu, Lingling, Jiang, Xiaoli, Xie, Fengjiao, Kausar, Saima, Liang, Dan, Wei, Guoqing, Zhu, Baojian, Wang, Lei, Liu, Chaoliang & Qian, Cen, 2020, The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species, pp. 533-552 in Zootaxa 4821 (3) on page 543, DOI: 10.11646/zootaxa.4821.3.6, http://zenodo.org/record/440109
FIGURE 2 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
No full textFIGURE 2. Comparison of the codon usage patterns within the mitochondrial genome of different Lepidoptera species.Published as part of <i>Wu, Lingling, Jiang, Xiaoli, Xie, Fengjiao, Kausar, Saima, Liang, Dan, Wei, Guoqing, Zhu, Baojian, Wang, Lei, Liu, Chaoliang & Qian, Cen, 2020, The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species, pp. 533-552 in Zootaxa 4821 (3)</i> on page 539, DOI: 10.11646/zootaxa.4821.3.6, <a href="http://zenodo.org/record/4401092">http://zenodo.org/record/4401092</a>
Going Beyond Counting First Authors in Author Co-citation Analysis
Get PDFThe present study examines one of the fundamental aspects of author co-citation analysis (ACA) - the way co-citation
counts are defined. Co-citation counting provides the data on which all subsequent statistical analyses and mappings
are based, and we compare ACA results based on two different types of co-citation counting - the traditional type that
only counts the first one among a cited work's authors on the one hand and a non-traditional type that takes into
account the first 5 authors of a cited work on the other hand. Results indicate that the picture produced through this non-traditional author co-citation counting contains more coherent author groups and is therefore considerably clearer. However, this picture represents fewer specialties in the research field being studied than that produced through the traditional first-author co-citation counting when the same number of top-ranked authors is selected and analyzed. Reasons for these effects are discussed
- …
