586 research outputs found

    The Tobermorite-Like Layer in Non-Tobermorite Minerals

    No full text
    The tobermorite-like layer (TLL) is a characteristic feature in all the structures of the natural and synthetic compounds of the tobermorite group /1/. In those structures eptahedra of calcium cations, characterized by ‘a pyramidal part on one side and a dome part on the other side joining the equatorial oxygen atoms’, form columns through edge sharing; the columns are connected each other, once again through edge sharing, and adjacent columns present the pyramidal apical ligands on opposite sides of the resulting infinite layers. These layers, decorated with wollastonite chains on both sides, build up the ‘complex layers’ which are the basic structural module in all the phases of the tobermorite group (Fig. 1). TLL is a recurrent feature in several natural phases belonging to distinct mineral groups. In the structures of the compounds of the rinkite group the TLL is decorated on both sides by disilicate groups and is accompanied by an infinite ‘octahedral’ layer in building up the structural arrangement. Dovyrenite /2/ and roumaite /3/ are closely related to the minerals of the rinkite group and differ only in the way of decoration of the TLL by the disilicate groups. Fukalite /4/ too presents the TLL, decorated on both sides by four-repeat silicate chains and carbonate groups; tilleyite-type polyhedral layers are also present as distinct modules in building up the structural arrangement. The ubiquitous occurrence of TLL is related to its chemical and structural flexibility: the chemical and geometrical variations of the TLL in the different structures are described and discussed. Key-words: layered silicates, crystal structures, mineralogical crystallography. References /1/ Merlino S., Bonaccorsi E., Armbruster T. (1999): American Mineralogist, 84, 1613–1621. /2/ Kadiyski M., Armbruster T., Galuskin E.V., Pertsev N.N., Zadov A.E., Galuskina I.O., Wrzalik R., Dzierżanowski P., Kislov E.V. (2008): American Mineralogist, 93, 456-462. /3/ Biagioni C., Bonaccorsi E., Merlino S., Parodi G.C., Perchiazzi N., Chevrier V. (2008): Plinius, 34, 211. /4/ Merlino S., Bonaccorsi E., Grabezhev A.I., Zadov A.E., Pertsev N.N., Chukanov N.V. (2009): American Mineralogist, 94, 323–333

    State of the Art on the European Court of Justice and Enacting Citizenship. CEPS Special Report, April 27 2009

    No full text
    This report provides a state of the art of the main interdisciplinary academic discussions, EU acts and European Court of Justice (ECJ) case law surrounding issues related to citizenship, migration and integration. The report was finalised in mid-2008 and has provided the basis upon which the work conducted by the Justice and Home Affairs Section at CEPS in the framework of the ENACT research project funded by DG Research of the European Commission has been developed. In particular, the general objectives of CEPS’ contribution to this project are: first, to assess the impact of Community governance on the enactment of European citizenship and the exclusivity of the nation-state competence over nationality matters; and to examine the ways in which the ECJ and the adoption of the Council Directive 2004/38/EC on the rights of citizens of the Union and their family members to move and reside freely have influenced its enactment; second, to analyse the impacts of the enlargement processes, and of accompanying measures such as the transitional arrangements inserted in the Acts of Accession and other restrictions to the fundamental right of freedom of movement, on the status and practices of European citizenship; and third, to assess the tensions inherent to nationality and/or residence-based enactment of citizenship versus European citizenship of TCNs; to address the effects and dilemmas posed by the Council Directive 2003/109/EC of November 2003 on the status of third country nationals who are long-term residents

    Séquences de traduction spontanée et phénomènes de contact de langues

    No full text
    Dans cette contribution, nous nous intéressons à des séquences de traduction spontanée qui se produisent au sein d’interactions plurilingues de type professionnel. Bien que dans ces contextes les locuteurs interagissent généralement en anglais lingua franca, il arrive souvent que, au fil de l’interaction, d’autres langues soient rendues disponibles : des alternances codiques sont en effet produites de manière marquée, suivies par la production du même contenu dans la langue de l’interaction et accompagnées par des commentaires métadiscursifs qui montrent un travail de comparaison effectué par les participants entre la langue de l’interaction et d’autres langues qui composent le répertoire plurilingue sous-jacent. Nous proposons de traiter ces moments, voire ce type particulier d’alternances codiques que sont les traductions spontanées, comme lieu d’observation de la manière dont les locuteurs s’orientent vers le contact de langues, catégorisent les ressources linguistiques et les langues de l’interaction (cf. Mondada, 2000) et évoquent la différence linguistique à toutes fins pratiques. Comme il a été montré dans la littérature, la traduction spontanée ou naturelle (Harris, 1977) peut concerner des applications locales et occasionnelles (cf. le continuum de Müller, 1989) qui sont finalisées non seulement à la gestion de la différence linguistique, mais aussi à la réalisation d’autres finalités pratiques (v. De Stefani et al., 2000 ; Margutti, 2007 ; Greer, 2008). Les séquences de traduction que nous examinons ici peuvent concerner des recherches lexicales mais aussi des productions du locuteur qui tracent des liens conceptuels et lexicaux à travers les langues : ces liens s’établissent non seulement par la production d’un mot dans une autre langue, explicitement catégorisé en tant que tel, mais aussi par la production progressive d’une traduction qui « calque » la forme « de départ » et introduit une relation de proximité entre les langues et les formes en question. Dans d’autres cas, au contraire, les locuteurs peuvent faire appel à une absence d’équivalences entre langues et invoquer la nature « intraduisible » de certains items. En adoptant une perspective praxéologique et conversationnelle sur les phénomènes de contact (cf. Auer, 1984 ; Lüdi, 1987; De Pietro, 1988 ; Firth, 1990 ; Gardner et Wagner, 2004 ; Mondada, 2004 ; Auer et Wei, 2007), nous contribuons à une vision émique de ces phénomènes et nous rendons compte des processus de co-construction de la différence linguistique telle qu’elle émerge dans les pratiques des locuteurs au sein de ces séquences de traduction. L’analyse s’appuie sur nombreuses heures d’enregistrements audio et vidéo de réunions de travail ayant lieu dans différents contextes internationaux

    Heterogeneous nucleation helps the search for initial crystallization conditions of γ-glutamyl transpeptidase from Bacillus licheniformis

    No full text
    Here, the crystallization and preliminary X-ray diffraction studies of Bacillus licheniformis γ-glutamyl transpeptidase (BlGT) are reported. The serendipitous finding of heterogeneous nucleants in the initial experiments provided the first crystallization conditions for the protein. Crystals were grown by hanging-drop vapour diffusion using a precipitant solution consisting of 20%(w/v) PEG 3350, 0.2 M magnesium chloride hexahydrate, 0.1 M Tris-HCl pH 8.2. The protein crystallized in the orthorhombic space group P2(1)2(1)2(1), with one heterodimer per asymmetric unit and unit-cell parameters a = 60.90, b = 61.97, c = 148.24 Å. The BlGT crystals diffracted to 2.95 Å resolution

    Spectroscopic/Computational Characterization and the X-ray Structure of the Adduct of the VIVO-Picolinato Complex with RNase A

    No full text
    The structure, stability, and enzymatic activity of the adduct formed upon the reaction of the V-picolinato (pic) complex [VIVO(pic)2(H2O)], with an octahedral geometry and the water ligand in cis to the V=O group, with the bovine pancreatic ribonuclease (RNase A) were studied. While electrospray ionization-mass spectrometry, circular dichroism, and ultraviolet-visible absorption spectroscopy substantiate the interaction between the metal moiety and RNase A, electron paramagnetic resonance (EPR) allows us to determine that a carboxylate group, stemming from Asp or Glu residues, and imidazole nitrogen from His residues are involved in the V binding at acidic and physiological pH, respectively. Crystallographic data demonstrate that the VIVO(pic)2 moiety coordinates the side chain of Glu111 of RNase A, by substituting the equatorial water molecule at acidic pH. Computational methods confirm that Glu111 is the most affine residue and interacts favorably with the OC-6-23-Δenantiomer establishing an extended network of hydrogen bonds and van der Waals stabilizations. By increasing the pH around neutrality, with the deprotonation of histidine side chains, the binding of the V complex to His105 and His119 could occur, with that to His105 which should be preferred when compared to that to the catalytically important His119. The binding of the V compound affects the enzymatic activity of RNase A, but it does not alter its overall structure and stability

    The X-ray structural view of the complex between human alpha thrombin and a DNA aptamer directed to exosite II

    No full text
    The aim of anticoagulant/antithrombotic therapy in cardiovascular disease is to prevent fibrin deposition and platelet aggregation, halting current and future ischemic episodes. The limitations to the effectiveness of the most commonly used agents (heparin, coumadin and aspirin) have led to the development of new anticoagulant compounds. In particular, aptamers represent an attractive approach because of their high specificity and low immunogenicity. The best known example is the Thrombin Binding Aptamer (TBA), namely 5‘GGTTGGTGT-GGTTGG3’[1]. TBA and its derivatives [2] adopt a G-quadruplex structure [2-6] and inhibit thrombin activity by blocking the fibrinogen binding site (exosite I) [3-6]. Biological properties of TBA are strictly dependent on its tertiary structure. Other antithrombotic aptamers have been identified using the SELEX process and partially characterized. Among them HD22, namely 5’GTCCGTGGTAGGGCAGGTTGGGGTGAC3’, is particularly interesting. It presents a 15-nucleotide core sequence that has striking similarity to TBA, and it has been reported to adopt a mixed duplex/quadruplex structure [7]. Remarkably HD22 binds thrombin with much higher affinity than TBA and has been shown to bind exosite II instead of exosite I [7]. No structural data on thrombin-HD22 complex has been reported so far. We have solved the X-ray structure of the thrombin-HD22 complex, with the aim to understand the molecular details of the interaction between the two molecules and to investigate the differences with respect to thrombin-TBA complex, whose structure we have recently determined at high resolution. These results could help the design of a new class of aptamers with an improved capability to modulate thrombin function. [1] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Nature, 355, 1992, 564. [2] L. Martino, A. Virno, A. Randazzo, A. Virgilio, V. Esposito, C. Giancola, M. Bucci, G. Cirino, L. Mayol, NAR, 34, 2006, 6653. [3] R.F. Macaya, P. Schultze, F.W. Smith, J.A. Roe, J. Feigon, PNAS USA, 90, 1993, 3745. [4] K. Padmanabhan, A. Tulinsky, Acta Crystallogr. D, 52, 1996, 272. [5] I. Russo Krauss, A. Merlino, A. Randazzo, L. Mazzarella, F. Sica, Acta Crystallogr F, 66, 2010, 961. [6] I. Russo Krauss, A. Merlino, C. Giancola, A. Randazzo, L. Mazzarella, F. Sica NAR, submitted [7] D.M. Tasset, M.F. Kubik, W. Steiner, JMB, 272(5), 1997, 688
    corecore