222 research outputs found
ASPÉK PSIKOLOGI DINA NOVEL RINI KARYA YOSEPH ISKANDAR (Ulikan Struktural jeung Psikologi Sastra)
Penelitian ini membahas struktur cerita dan aspek psikologi tokoh utama yang terdapat di dalam novel Rini karya Yoseph Iskandar. Tujuan dalam penelitian ini untuk mendeskripsikan (1) tema, (2) fakta carita, (3) sarana carita, dan (4) psikologi tokoh utama yang terdapat dalam novél Rini karya Yoseph Iskandar. Metode yang digunakan adalah deskriptif analitis dengan teknik studi pustaka. Hasil penelitian menunjukan bahwa (1) tema dalam novel Rini ini adalah kehidupan dan takdir mengenai jodoh, kematian, dan kebahagiaan. (2) fakta cerita yang terdapat dalam novel Rini terbagi menjadi alur, latar, dan pelaku; alur cerita dibagun oleh 12 episode dengan alur maju; pelaku dibagi menjadi pelaku utama dan pelaku tambahan, terdapat tiga pelaku utama dan 13 pelaku tambahan; latar dalam cerita pun terbagi menjadi tiga, dengan 9 latar tempat, 8 latar waktu, dan latar sosial mengenai bahasa serta lingkungan, (3) sarana sastra yang terdapat dalam novel Rini terbagi menjadi judul, sudut pandang, dan gaya bahasa; judul Rini menggambarkan isi cerita; sudut pandang yang digunakan oleh penulis merupakan sudut pandang orang pertama “saya” sebagai pelaku utama; gaya bahasa yang ditemukan di antaranya simile, personifikasi, hiperbola, pleonasme, eufimisme, metafora, dan litotes, (4) psikologi kepribadian tokoh utama yang terdapat dalan novel Rini mencakup 3 macam karakteristik psikologi dalam diri manusia di antaranya id, ego, superego. This study discusses the structure of the story and the psychological aspects of the main character in the novel Rini by Yoseph Iskandar. The purpose of this study is to describe (1) the theme, (2) the facts of the story, (3) the means of the story, and (4) the psychology of the main character in Yoseph Iskandar's novel Rini. The method used is descriptive analytical with literature study technique. The results show that (1) the theme in Rini's novel is life and destiny regarding mate, death, and happiness. (2) the facts of the story contained in Rini's novel are divided into plot, setting, and actors; the storyline is built by 12 episodes with a forward plot; actors are divided into main actors and additional actors, there are three main actors and 13 additional actors; The setting in the story is also divided into three, with 9 place settings, 8 time settings, and social settings regarding language and environment, (3) the literary tools contained in Rini's novel are divided into titles, points of view, and language styles; Rini's title describes the content of the story; the point of view used by the author is the first person point of view “me” as the main actor; The language styles found include simile, personification, hyperbole, pleonasm, euphemism, metaphor, and litotes, (4) personality psychology of the main character in Rini's novel includes 3 kinds of psychological characteristics in humans including id, ego, and superego
L'analisi aristotelica dei relativi
This article discusses the ontological status of the parts of substances in Aristotle’s theory of categories. Since in this theory the substantial parts, as well as the wholes, are primary subjects of predication, i.e. substances, a part may be to its whole as Socrates is to Callias so that the mereological composition of substances can be regarded as an accident (a relation). It is argued here that in Cat. 7 Aristotle is trying to rule out this possibility by redefining the boundaries of the category of relatives itself. Starting from the framework of the Academic debate and then following closely the text of Cat. 7, the author provides a detailed reconstruction of Aristotle’s argument in order to establish the reason for which the parts of substances
hold such an uncertain status. Furthermore, he shows that the Categories do not provide a definitive solution to the mereological problem, which has rather to be sought in the Metaphysics. The following results are attained: a moderately systematic component is revealed in Aristotle’s Categories and a mereological element is detected in the very core of his theory of substance
T : A Data-Centric, Cyber-Physical Cooling Energy Costs Reduction
Explosion in Big Data has led to a surge in extremely large-scale Big Data Analytic platforms, resulting in burgeoning energy costs. Big Data compute model mandates strong data-locality for computation performance due to Big Data inertia and bandwidth constraints, and moves computations to data. State-of-the-art cooling energy management techniques rely on thermal-aware computational job placement/migration and are inherently data agnostic in nature. T* takes a novel data-centric approach to reduce cooling energy costs. On the physical side, T* is cognizant of the thermal-profile in the data centers. On the cyber-side, T* is aware of the differences in the data-semantics (i.e., computational job profile, job rate, and life spans) of the Big Data placed in the compute cloud. Based on this knowledge, and coupled with its predictive data models, T* does proactive, cyber-physical, thermal-aware data placement, which implicitly results in thermal-aware job placement in the Big Data Analytics cloud compute model. Evaluation results with one-month long real-world Big Data analytics production traces show up to 59% reduction in the cooling energy costs with T* while performing 9x better than the state-of-the-art data agnostic cooling techniques in the Big Data environment.Submitted by Rini Kaushik ([email protected]) on 2012-05-04T04:45:04Z
No. of bitstreams: 1
paper_fast (2).pdf: 1018130 bytes, checksum: 3ba64f6c38514916ccb3fc3855ff5c0d (MD5)Made available in DSpace on 2012-05-04T04:45:04Z (GMT). No. of bitstreams: 1
paper_fast (2).pdf: 1018130 bytes, checksum: 3ba64f6c38514916ccb3fc3855ff5c0d (MD5)
Previous issue date: 2011-05-01Item withdrawn by Rini Kaushik ([email protected]) on 2012-05-04T04:45:04Z
Item was in collections:
Computer Science Conference Proceedings & Workshop Materials (ID: 585)
No. of bitstreams: 1
paper_fast (2).pdf: 1018130 bytes, checksum: 3ba64f6c38514916ccb3fc3855ff5c0d (MD5)Restriction data tranferred 2014-07-01T11:09:35-05:00
Original Data
Group with Access Administrator
Release Date: none
Reason: Author needs to update reportItem marked as completely restricted (or under embargo) by Rini Kaushik ([email protected]) on 2012-05-04T04:45:04Z
Item is restricted until 2012-08-04T04:38:42ZItem reinstated by Sarah Shreeves ([email protected]) on 2012-09-07T16:43:41Z
Item was in collections:
Computer Science Conference Proceedings & Workshop Materials (ID: 585)
No. of bitstreams: 1
paper_fast (2).pdf: 1018130 bytes, checksum: 3ba64f6c38514916ccb3fc3855ff5c0d (MD5)Item released from any restrictions by Sarah Shreeves ([email protected]) on 2012-09-07T16:43:41ZItem marked as restricted to the 'Administrator' Group (id=1) by Jacob Nash ([email protected]) on 2012-11-05T19:15:30Z
Item is restricted indefinitely.Author needs to update reportpublished or submitted for publicationLimite
PEMERIKSAAN FISIK DAN UJI DIAGNOSTIK KEBIDANAN
PEMERIKSAAN FISIK DAN UJI DIAGNOSTIK KEBIDANAN
Penulis:
Siti Rohani, SST., Bdn., M.Kes.
Filda Fairuza, S.ST., Bd., M.Kes.
Juwita Desri Ayu, S.Tr.Keb., M.Keb.
Bdn. Indah Christiana, S.ST., M.Kes.
Lutfiana Puspita Sari, S.ST., Bdn., MPH.
Atik Mahmudah Aji Pamungkas, S.Tr.Keb., M.Keb.
Ike Putri Setyatama, S.ST., M.Kes.
Eni Sulastri, SST., M.Keb.
Rini Wahyuni, S.ST., Bdn., M.Kes.
Lusinta Agustina, SST., Bdn., M.Keb.
Dewi Puspitaningrum, S.Si.T., M.Kes.
Bd. Dewi Mayangsari, S.Si.T., M.Kes.
Diyah Chadaryanti, S.ST., M.Kes.
Bdn. Dewi Susilawati, S.ST., M.Kes.
Lia Aria Ratmawati, SST., M.Kes.
ISBN: 978-623-09-7895-1
Tebal: xi + 236 hlm., 23 x 15.5 cm
Januari 2024
Editor: Nurul Eko Widiyastuti, S.Si.T., M.Kes.
Penata Letak: Liska Rahmayana
Penata Sampul: Adiktiya Harahap
Penerbit:
PT. ADIKARYA PRATAMA GLOBALINDO
Dusun Tegalsari RT 001/RW 004, Desa Jumoyo, Kec. Salam
Kabupaten Magelang, Provinsi Jawa Tengah
HP/WA: 08989999951, Email: [email protected]
Website: www.adpraglobalindo.my.i
Riverfront remake: What vision is the city crafting, and for whom?
Part of a series of forums that Douglas College is hosting in partnership with SFU and the City of New Westminster. The goal of these forums is to provide an occasion for frank discussion on important issues facing urban and suburban communities, to both inform and learn from academics, practitioners, and citizens. New Westminster's most significant cultural, economic, and natural asset, the riverfront, is slated for major change. How is the city going to balance history, housing, business, and tourism, while creating a vibrant and welcoming space for all?
Welcome and Moderator: Rini Sumartojo (Geography), Humanities and Social Sciences (Douglas College).
Panelists:
Mark Allison, Manager, Strategic Initiatives and Sustainability, City of New Westminster. Mark is a community and regional planner, systems engineer, and scientist. Previously, he has held positions overseeing the Whistler Center for Sustainability’s Advisory Services, as well as acting as the senior policy planner for the City of Surrey. Mark has long been an advocate of sustainable development, smart growth, and transit-oriented development. In addition to his most recent positions has worked as a transportation planner, a regional growth strategy coordinator, and a sustainability planning consultant. (3:13)
Dr. Eugene McCann, Humanities and Social Sciences (SFU). A professor of Geography at Simon Fraser University, he researches urban policy making, policy mobilities, planning, public space, and urban politics. He has a long-standing interest in the policies of city marketing. Eugene is the co-author of a book entitled Urban Geography: A Critical Introduction as well as the co-editor of two books: one entitled Mobile Urbanisms: Cities and Policy Making in the Global Age and the other entitled Cities and Social Change. He’s published in a wide range of journals and is the managing editor of the journal Environment and Planning C: Politics and Space. (21:17)
Q&A with panelists (45:26)</p
FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL
Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG
IDENTIFIKASI FRAGMEN DNA MIOGLOBIN SEPANJANG 114PB PADA BEBERAPA JENIS HEWAN LAUT YANG MAMPU HIDUP PADA ZONA MINIMUM OKSIGEN
ABSTRACT
Myoglobin is a hemoprotein that contributes to intracellular oxygen storage and facilitates diffusion oxygen into mitochondria. Myoglobin production will increase as low levels of environmental oxygen called hypoxia. When oxygen in tissue is low, the body will respond by forming myoglobin in some tissues, such as muscle tissue. The aims of this study was to detect DNA fragments of myoglobin along 114pb in muscle tissue of marine animals are capable to live in the oxygen minimum zone, such as the green turtle, mackerel tuna and hammerhead sharks. The oxygen minimum zone is zone of oceans which have low dissolved oxygen levels at > 1,4μLO2L-1, the oxygen levels can be categorized as hypoxic conditions. This study was conducted in the Biochemistry laboratory, State University of Jakarta. This study used descriptive method by PCR and electrophoresis. The results indicated that myoglobin found in muscles of marine animals were capable live in oxygen minimum zone such as the green turtle, mackerel tuna and hammerhead shark. This information can be used as the basic that the tissue able to make adaptation strategy towards low oxygen environmental levels by increasing formation of myoglobin in muscle tissue.
Kata kunci: Myoglobin DNA, Green Turtle, Mackerel Tuna and Hammerhead Shark
PENERAPAN PROGRAM REMEDIAL DALAM PEMBELAJARAN BIOLOGI DI SEKOLAH MENENGAH ATAS
Abstract: Remedial learning can improve learning achievement of learners so as to achieve a minimum completeness criteria specified. Remedial learning is learning to be a good therapeutic or cured, from the difficulty to master certain competencies expected in learning. Remedial education in Indonesia is regulated by the Ministry of Education. This study was conducted to determine the feasibility remedial procedure, performed senior high school biology teacher in Bekasi, based Juknis made by the Education Ministry, 2010. The method used is descriptive method, with survey techniques. The result showed that, the implementation of remedial highly dependent on the condition of each school. School conditions were observed in this study can be grouped into three grade, namely grade A, B and C. The procedure implementation of remedial in senior high school Bekasi, not in accordance with the National Education Ministry, but only one school. The few things that have not been appropriate including instructional time, remedial test questions do not test any indicator incomplete, remedial tests given before students follow a remedial learning, relearning not use different methods and media.
Abstrak: Pembelajaran remedial dapat meningkatkan prestasi belajar peserta didik sehingga mencapai kriteria ketuntasan minimal yang ditentukan. Pembelajaran remedial adalah belajar untuk menjadi baik terapeutik atau sembuh, dari kesulitan untuk menguasai kompetensi tertentu diharapkan dalam pembelajaran. Perbaikan pendidikan di Indonesia diatur oleh Departemen Pendidikan. Penelitian ini dilakukan untuk mengetahui kelayakan prosedur perbaikan, dilakukan guru biologi SMA di Bekasi, Juknis berdasarkan dibuat oleh Departemen Pendidikan, 2010. Metode yang digunakan adalah metode deskriptif, dengan teknik survei. Hasil penelitian menunjukkan bahwa, pelaksanaan perbaikan sangat tergantung pada kondisi masing-masing sekolah. Kondisi sekolah yang diamati dalam penelitian ini dapat dikelompokkan menjadi tiga kelas, yaitu kelas A, B dan C. Pelaksanaan Prosedur perbaikan di SMA Bekasi, tidak sesuai dengan Departemen Pendidikan Nasional, tetapi hanya satu sekolah. Beberapa hal yang belum sesuai termasuk waktu pembelajaran, pertanyaan tes remedial tidak menguji setiap indikator yang tidak lengkap, tes remedial diberikan sebelum siswa mengikuti pembelajaran remedial, belajar kembali tidak menggunakan metode dan media yang berbeda
Pengaruh Paparan Hipoksia terhadap Aktivitas Antioksidan Katalase dan Kadar Malondialdehid (MDA) pada Jaringan Hati Tikus
Abstract
content in the tissue. Hypoxia can make the formation of free radicals or reactive oxygen species (ROS) which reactive to cell membrane. Body will avoid free radicals by producing antioxidant, such as catalase enzyme. The reaction between ROS and cell membrane will form malondialdehyde (MDA). Liver is the main location of catalase. This research was aimed to know the influence of hypoxia exposure toward catalase antioxidant activity and MDA content in the rat liver tissue. This research used experiment method with fully randomized design. Based on one way Anova test (p≤0.01), it was shown that there had no average difference on catalase activity and MDA content toward length hypoxia exposure. The conclusion of this research was no influence of hypoxia exposure toward catalase activity and MDA content in rat liver tissue.
Key words: catalase antioxidant activity, hypoxia, malondialdehyde (MDA) content,rat liver tissu
ANALISIS KREDIT MACET PADA PT. BANK TABUNGAN NEGARA (PERSERO) Tbk. CABANG SOLO
ABSTRACT
ANALYSIS OF RESTRUCTION CREDIT IN BANK TABUNGAN NEGARA (PERSERO)
BRANCH OF SOLO
RINI FITRIYANTI
F3308168
Restruction credit is one ofcollectability in problem’scredit, credit can be category of
restruction if there are back payment and debt interest more than 270 days from date of
maturity. The aims of the research are to know the development of Bank Tabungan Negara
(Persero) branch of Solo if have seen from restructionkredit at BTN, and whether causal
factor of restruction credit as well as way of handle of restruction credit. The analysis use
direct sampling or observation, and face to face dialog with employee. Research can be used
as consideration substance to evaluation handle restruction credit in Bank Tabungan Negara
(Persero) branch of Solo.
Based on the analysis restruction credit in Bank Tabungan Negara (Persero) branch
of Solo founds strength and weakness. These advantages include : the development of BTN is
good that is can be seen from more and more amount of realization of credit KPR-Non KPR
and general credit and amount of non performing loan (NPL) under maximal limit BI is
5%.There are also some weakness that is amount percentase of restruction credit more and
more from year of year during 2008-2010, and development of credit very weak with the
result that amount of restruction credit and NPL more and more from year of year.
Based on result research, it can be concluded that the analysis restruction credit in
Bank Tabungan Negara (Persero) branch of Solo, the author give some suggestion to be
consideration for Bank Tabungan Negara (Persero) branch of Solo such as development of
credit must be done with effective and debitor with collectability of DPK (consider) must be
given development of credit too because debitor with collectability of DPK can be debitor
with collectability of problem and always monitoring of back payment and interest debitor
- …
