4,926 research outputs found
Y(4143) is probably a molecular partner of Y(3930)
No full textAfter discussing the various possible interpretations of the Y(4143) signal observed by the CDF collaboration in the J/Sigma phi mode, we tend to conclude that Y(4143) is probably a D(s)(*)D(s)(*) molecular state with J(PC)=0(++) or 2(++) while Y(3930) is its D(*)D(*) molecular partner as predicted in our previous work [X. Liu, Z. G. Luo, Y. R. Liu, and Shi-Lin Zhu, Eur. Phys. J. C 61, 411 (2009)]. Both the hidden-charm and open-charm two-body decays occur through the rescattering of the vector components within the molecular states while the three- and four-body open-charm decay modes are forbidden kinematically. Hence, their widths are narrow naturally. CDF, BABAR and Belle collaborations may have discovered heavy molecular states already. We urge experimentalists to measure their quantum numbers and explore their radiative decay modes in the future.Astronomy & AstrophysicsPhysics, Particles & FieldsSCI(E)50ARTICLE1null8
Vascular endothelial growth factor restores delayed tumor progression in tumors depleted of macrophages
No full textGenetic depletion of macrophages in Polyoma Middle T oncoprotein (PyMT)-induced mammary tumors in mice delayed the angiogenic switch and the progression to malignancy. To determine whether vascular endothelial growth factor A (VEGF-A) produced by tumor-associated macrophages regulated the onset of the angiogenic switch, a genetic approach was used to restore expression of VEGF-A into tumors at the benign stages. This stimulated formation of a high-density vessel network and in macrophage-depleted mice, was followed by accelerated tumor progression. The expression of VEGF-A led to a massive infiltration into the tumor of leukocytes that were mostly macrophages. This study suggests that macrophage-produced VEGF regulates malignant progression through stimulating tumor angiogenesis, leukocytic infiltration and tumor cell invasion
812776_supp_mat – Supplemental material for FDA-Catalyst—Using FDA’s Sentinel Initiative for large-scale pragmatic randomized trials: Approach and lessons learned during the planning phase of the first trial
No full textSupplemental material, 812776_supp_mat for FDA-Catalyst—Using FDA’s Sentinel Initiative for large-scale pragmatic randomized trials: Approach and lessons learned during the planning phase of the first trial by Noelle M Cocoros, Sean D Pokorney, Kevin Haynes, Crystal Garcia, Hussein R Al-Khalidi, Sana M Al-Khatib, Patrick Archdeacon, Jennifer C Goldsack, Thomas Harkins, Nancy D Lin, David Martin, Debbe McCall, Vinit Nair, Lauren Parlett, Robert Temple, Cheryl McMahill-Walraven, Christopher B Granger and Richard Platt in Clinical Trials</p
Uniqueness results for mean field equations with singular data
No full textWe prove uniqueness of solutions for mean field equations (Caglioti et. Al. Comm. Math. Phys. 174 (1995)) with singular data (Bartolucci et Al. Comm. Math. Phys. 229 (2002)),
arising in the analysis of two-dimensional turbulent Euler flows.
In this way, we generalize to the singular case some uniqueness results obtained by
Chang, Chen and the second author (Chang et. Al. New Stud. Adv. Math. 2 (2003)). In particular,
by using a sharp form of an improved
Alexandrov-Bol's type isoperimetric inequality, we are able to exploit the role played by
the singularities and then obtain uniqueness under weaker boundary regularity assumptions than those
assumed in (Chang et. Al. New Stud. Adv. Math. 2 (2003))
Liphistius liz Lin & Li 2023, sp. nov.
No full text<p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329
Author Co-Citation Analysis (ACA): a powerful tool for representing implicit knowledge of scholar knowledge workers
No full textIn the last decade, knowledge has emerged as one of the most important and valuable organizational assets. Gradually this importance caused to emergence of new discipline entitled ―knowledge management‖. However one of the major challenges of knowledge management is conversion implicit or tacit knowledge to explicit knowledge. Thus Making knowledge visible so that it can be better accessed, discussed, valued or generally managed is a long-standing objective in knowledge management. Accordingly in this paper author co- citation analysis (ACA) will be proposed as an efficient technique of knowledge visualization in academia (Scholar knowledge workers)
Deletion of vitamin D receptor leads to premature emphysema/COPD by increased matrix metalloproteinases and lymphoid aggregates formation
No full textDeficiency of vitamin D is associated with accelerated decline in lung function. Vitamin D is a ligand for nuclear hormone vitamin D receptor (VDR), and upon binding it modulates various cellular functions. The level of VDR is reduced in lungs of patients with chronic obstructive pulmonary disease (COPD) which led us to hypothesize that deficiency of VDR leads to significant alterations in lung phenotype that are characteristics of COPD/emphysema associated with increased inflammatory response. We found that VDR knock-out (VDR(-/-)) mice had increased influx of inflammatory cells, phospho-acetylation of nuclear factor-kappaB (NF-κB) associated with increased proinflammatory mediators, and up-regulation of matrix metalloproteinases (MMPs) MMP-2, MMP-9, and MMP-12 in the lung. This was associated with emphysema and decline in lung function associated with lymphoid aggregates formation compared to WT mice. These findings suggest that deficiency of VDR in mouse lung can lead to an early onset of emphysema/COPD because of chronic inflammation, immune dysregulation, and lung destruction
Existence and uniqueness for Mean Field Equations on multiply connected domains at the critical parameter
No full textWe consider the mean field equation:
Δu + ρ
u = 0
e u
e u
Ω
= 0 in Ω,
(1)
on ∂Ω,
where Ω ⊂ R 2 is an open and bounded domain of class C 1 . In his 1992 paper, Suzuki
proved that if Ω is a simply-connected domain, then Eq. (1) admits a unique solution
for ρ ∈ [0, 8π ). This result for Ω a simply-connected domain has been extended to the
case ρ = 8π by Chang, Chen and the second author. However, the uniqueness result
for Ω a multiply-connected domain has remained a long standing open problem which
we solve positively here for ρ ∈ [0, 8π ]. To obtain this result we need a new version
of the classical Bol’s inequality suitable to be applied on multiply-connected domains.
Our second main concern is the existence of solutions for (1) when ρ = 8π . We obtain
a necessary and sufficient condition for the solvability of the mean field equation at
ρ = 8π which is expressed in terms of the Robin’s function γ for Ω. For example,
if Eq. (1) has no solution at ρ = 8π , then γ has a unique nondegenerate maximum
point. As a by product of our results we solve the long-standing open problem of the equivalence of canonical and microcanonical ensembles in the Onsager’s statistical
description of two-dimensional turbulence on multiply-connected domains
Spin-orbit force, recoil corrections, and possible B(B)over-bar* and D(D)over-bar* molecular states
No full textIn the framework of the one-boson exchange model, we have calculated the effective potentials between two heavy mesons B (B) over bar* and D (D) over bar* from the t- and u-channel pi-, eta, rho-, omega-, and sigma-meson exchanges with four kinds of quantum number: I = 0, J(PC) = 1(++); 1 = 0, J(PC) = 1(+-); I = 1, J(PC) = 1(++); I = 1, J(PC) = 1(+-). We keep the recoil corrections to the B (B) over bar* and D (D) over bar* systems up to O(1/m(2)) The spin-orbit force appears at O(1/M), which turns out to be important for the very loosely bound molecular states. Our numerical results show that the momentum-related corrections are unfavorable to the formation of the molecular states in the I = 0, J(PC) = 1(++) and I = 1, J(PC) = 1(+-) channels in the D (D) over bar* system.Astronomy & AstrophysicsPhysics, Particles & FieldsSCI(E)[email protected]; [email protected]; [email protected]
- …
