679 research outputs found
La parola ai bambini. A proposito di un recente studio sul «Giornalino della Domenica» di Vamba
No full textThis paper, which is based on the contributions of Roberto Sani, Lorenzo Cantatore, Michela D’Alessio and Alberto Barausse, has the objective of presenting and discussing the recent book by Rossella Andreassi, entitled «Caro Vamba». La Corrispondenza de Il Giornalino della Domenica (1906-1911). Il progetto di Luigi Bertelli per l’educazione civile dell’infanzia (Lecce, Pensa Multimedia, 2023). The work is notable for its methodology and the distinctive nature of the sources employed; it concentrates on the noteworthy publishing endeavor initiated by Bertelli in 1906 and his seminal project of promoting democratic and civil education. Of particular significance is the journal’s correspondence section, which afforded children a legitimate space in the democratic process, enabling their active participation, integration and, most crucially, their voices to be heard
Differenze di genere nell’approccio allo studio e nella scelta della facoltà universitaria: un intervento di orientamento nell’Università La Sapienza di Roma
No full textLo scavo alla pendice nord-orientale del Palatino: le ultime fasi di occupazione
No full textThe first results of the excavation activities on the north-eastern slope of the Palatine Hill are presented here.
During the first six campaigns (2017-2022) of the research project, it was possible to collect data on the last phases
of occupation of the area. After an historical and archaeological overview of the site, the paper focuses on what
happened following the abandonment of the structures in the Imperial Age and the end of the productive activities
that had taken place there in Late Antiquity. The stratigraphic sequence and relative dating materials are then
reviewed, proposing a reconstruction of the most recent periods (16th - 19th century) identified
Classification of microcirculation diseases with quantitative parameters from nailfold capillaroscopy
No full textDevelopment of an ESI-MS method for DNA-ligand screening applied to recognition of T:G mismatched base pairs
No full textIntroduction
TG mismatched base pairs in DNA are responsible for most of the common mutations leading to formation of tumors in humans. TG mismatches are particularly abundant in cells lacking mismatch repair mechanism (MMR). MMR deficiency increases 50-1000-fold spontaneous mutation rates (microsatellite instability MSI). An increase of MSI is observed in hereditary nonpolyposis colon cancer (HNPCC) and in a series of sporadic tumor types. In addition, MMR deficiency can lead to resistance to several chemotherapeutic agents (DNA damaging agent). The aim of the present work is the development and validation of an ESI-MS screening method for the identification of new molecules able to recognize TG mismatched base pairs in DNA.
Method
ESI MS spectra were recorded on a Waters Q-Tof Ultima mass spectrometer with negative ion detection. Ions were generated under the following conditions: ESI sprayer voltage 2.0 kV, desolvation temperature 150°C, source block temperature 70°C, cone voltage 50V, and collision energy 5V. Samples were analyzed by continuous infusion at 5 uL/min. The acquired mass range was 500-2000 Da with a scan time set to 2 s. Different self complementary DNA sequence were synthesized. The duplex fully matched sequence was formed from the single strand d(GAACCGGTTC) and was used as control. A duplex DNA structure incorporating two T:G mismatched base pairs were obtained from the sequence d(GAACTGGTTC). Solutions of oligonucleotides were heated to 90°C for 5 min to form duplexes.
Preliminary result
Different papers confirm that the duplex DNA structure is maintained in the gas phase and the Watson-Crick base pairing is preserved [1,2]. In our study the formation of duplexes was confirmed by ESI-MS and dissociation curves were obtained for the different oligonucleotides confirming a decreasing stability of the duplexes when TG mismatches are present. Since a tandem T:G/G:T mismatch is seldom found in vivo, an hairpin DNA sequence d(GAACTGGTCCTCTGACTGGTTC) bearing a single T:G mismatch was prepared. This hairpin DNA was used to set up the method for studying the complexes formed with minor groove binders (distamycin A, Hoechst 33258, Hoechst 33342, DAPI) and intercalators (doxorubicin). One of the first investigated conditions was the concentration of ammonium acetate buffer. In the spectra obtained for the interaction between the hairpin (single mismatch) and distamycin A; both 1:1 and 1:2 drug-DNA complexes are present. A dependence of the buffer concentration on the binding was evidenced with an appreciable reduction of the distamycin adduct intensity at higher ammonium acetate concentration, moving from 20 to 100 mM. The dissociation constant of the complexof DNA hairpin and distamycin A was determined by holding the oligonucleotide concentration at 10 uM and titrating with distamycin A. The Kd values were calculated directly from the MS spectra intensities at different concentration. The obtained average value (K=[K1*K2]1/2) of 61 uM is in agreement with the 83 uM obtained by Surface Plasmon Resonance [3]. Experiments on imidazole analogs of distamycin, demonstrated to be selective for TG base pair [3] by mean of other techniques (SPR, NMR) are now ongoing. [1] Schnier, PD; Klassen, JS; Strittmatter, EF; Williams, ER; J. Am. Chem. Soc. 120 (1998) 9605[2] Gabelica, V; De Pauw, E; Int. J. Mass Spectrom 219 (2002) 151[3] Lacy, ER; Cox, KK; Wilson, WD; Lee, M; Nucleic Acid Res 30/8 (2002) 1834
Novel Aspect
Application of ESI-MS to the study of TG mismatched DNA and development of screening methods for identifying selective ligands
The long-wavelength view of GG Tau A: rocks in the ring world
No full textWe present the first detection of GG Tau A at centimetre wavelengths, made with the Arcminute Microkelvin Imager Large Array at a frequency of 16 GHz (λ = 1.8 cm). The source is detected at >6 σrms with an integrated flux density of S16GHz = 249 ± 45 µJy. We use these new centimetre-wave data, in conjunction with additional measurements compiled from the literature, to investigate the long-wavelength tail of the dust emission from this unusual protoplanetary system. We use an MCMC-based method to determine maximum likelihood parameters for a simple parametric spectral model and consider the opacity and mass of the dust contributing to the microwave emission. We derive a dust mass of Md ~ 0.1 Msun, constrain the dimensions of the emitting region and find that the opacity index at λ > 7 mm is less than unity, implying a contribution to the dust population from grains exceeding ~4 cm in size. We suggest that this indicates coagulation within the GG Tau A system has proceeded to the point where dust grains have grown to the size of small rocks with dimensions of a few centimetres. Considering the relatively young age of the GG Tau association in combination with the low derived disc mass, we suggest that this system may provide a useful test case for rapid core accretion planet formation models
Transient quasi-static passive model of the upper limb under surface electrical stimulation: finite integration based approach
No full textEffectiveness of plant-derived formulations against the root-knot nematode Meloidogyne incognita (Kofoid et White) Chitw. in a protected tomato crop
No full textThe effectiveness of two plant-derived formulations for the control of the root-knot Meloidogyne incognita (Kofoid et White) Chitw. was evaluated in a protected tomato crop in Southern Italy. A neem oil-based formulation and a commercial mixture of aqueous extracts of Quillaja saponaria Molina (80%), Yucca schidigera Roezl (10%) and Tagetes spp. (10%) were tested in comparison with the standard chemical oxamyl and an untreated control. All tested formulations significantly decreased soil nematode population and average root galling compared to the untreated control. However, nematode infestation was found significantly lower in plots treated with oxamyl or neem formulation than in those treated with quillay-based product. Tomato yield did not significantly differ among treatments. Satisfactory yield obtained by quillay-based product appears to be caused by the biostimulating effect of quillay extract on tomato plants
Parenting stress in employed and at-home mothers in Italy.
No full textIn Italy, there has been strong cultural support for motherhood as the ideal female role. As increasing numbers of Italian mothers enter the workforce, little is known about the effects of maternal employment. An examination of parenting
stress that included work status and Type A Behavior Pattern (TABP) was conducted with 174 employed and at-home mothers in Italy. Higher TABP was associated with higher maternal stress in employed mothers and more stressful parent-child interactions
for at-home mothers. The strength of the relationship between parenting stress and TABP varies by maternal work status and parenting stress domain. Considering these results, personality characteristics that are incongruent with feminine gender
schema may be especially relevant to the prediction of parenting stress
- …
