1,720,960 research outputs found
Las amenazas fitosanitarias de la horticultura en un contexto de cambio climático
Los cultivos agrícolas, y en particular los hortícolas, están sometidos cada vezmás a la presión de enfermedades, plagas y malezas. Esto se debe a diferentes factores como por ejemplo el cambio climático, que es una de las principales amenazas de la actividad agrícola.Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Brugo Carivali, Maria Florencia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Cabrera Mederos, Dariel. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentin
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; ArgentinaFil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentin
infecting rice in Sierra Leone
While Rice stripe necrosis virus (RSNV, Benyvirus, Benyviridae) has been reported on rice plants on two continents, little is known about the diversity of this multipartite virus which is transmitted by the plasmodiophorid protist Polymyxa graminis. First identified in 1983 in the Côte d´Ivoire (Fauquet & Thouvenel, 1983), the disease had previously been observed in Sierra Leone without formal identification of the causal agent (Buddenhagen, pers. comm.). Later, the virus was reported in South and Central America (Colombia, Ecuador, Panama and Brazil) causing up to 40% yield losses (Morales et al., 1999). Recently, RSNV was identified for the first time in several African countries including Burkina Faso (Sérémé et al., 2014), Benin (Oludare et al., 2015) and Mali (Decroës et al., 2017) suggesting a re-emergence of the virus in Africa.In 2019, symptoms of leaf-crinkling and stripe necrosis were observed on a rice plant from the Bo District in Sierra Leone (Fig. 1). Leaf samples were analysed by serological and molecular methods to confirm the presence of RSNV in Sierra Leone. RSNV was detected by plate-trapped antibody (PTA)- ELISA using a polyclonal antiserum against RSNV (Fauquet & Thouvenel, 1983).The presence of the virus was confirmed after total RNA extraction using 0.05 g of leaves and the RNeasy Plant Mini Kit (Qiagen) and RT-PCR amplification (10 U/μl M-MLV-reverse transcriptase, Promega; 10 U/μl Dynazyme, Finnzyme) as described previously (Sérémé et al., 2014, Oludare et al., 2015) with primers RSNV1-2901F 5′-TGAATTTGGTGCTCTCTTG-3′ / RSNV1-3827R 5′-TGTGGCGTTTCCAGACCTAAA-3´ and RSNV2-5´ 5´-TATCACTACTGACGAATTCCACCTAC-3´ / RSNV2-1223R 5´-AATCTGCGGCCTGTTTTGTA-3´. Specific amplicons, 926 and 1241 nt in length, were generated corresponding to sequences in the helicase domain and the coat protein (CP) genes on RSNV RNA 1 and RNA 2, respectively. The amplicons were sequenced directly and the sequences deposited in GenBank (Accession Nos. MN750254 and MN750255, respectively).The helicase sequence obtained from the Sierra Leone RSNV isolate showed 1.8-7.3% genetic distance with those from South America (EU099844.3, MG792544, MG792545, MG792546) and only 1.4-2.2% with those from Africa (KP099623, MF115599, MF115600, MF115601, MF115602, MF115603, MK170452, MK170453). The phylogenetic analysis based on the helicase domain included the sequence obtained from the Sierra Leone within a cluster represented by RSNV from South America and West Africa (Fig. 2a). In contrast, the CP sequence from the Sierra Leone RSNV isolate revealed an unexpected genetic differentiation as compared to all the other sequences from South America (5.6%; NC_038774) or Africa (5.2-6.5%; LK023710, MF115604, MF115605, MF115606, MF115607, MF115608, MK170454, MK170455). Interestingly, the CP sequence from Sierra Leone is located at a basal position in the phylogeny (Fig. 2b).To our knowledge, this is the first confirmed report of RSNV in Sierra Leone. Further studies are needed to assess the molecular and biological diversity of RSNV, the spatial distribution and the incidence of this re-emerging rice disease in Africa.Fil: Tucker, M. J.. Sierra Leone Agricultural Research Institute; Sierra LeonaFil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatología y Modelización Agrícola - Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba. Unidad de Fitopatología y Modelización Agrícola; ArgentinaFil: Conteh, A. B.. Sierra Leone Agricultural Research Institute; Sierra LeonaFil: Taylor, D. R.. Sierra Leone Agricultural Research Institute; Sierra LeonaFil: Hebrard, Andrés. Centre National de la Recherche Scientifique. Institut de Recherche pour le Développement; FranciaFil: Poulicard, N.. Centre National de la Recherche Scientifique. Institut de Recherche pour le Développement; Franci
Going Beyond Counting First Authors in Author Co-citation Analysis
The present study examines one of the fundamental aspects of author co-citation analysis (ACA) - the way co-citation
counts are defined. Co-citation counting provides the data on which all subsequent statistical analyses and mappings
are based, and we compare ACA results based on two different types of co-citation counting - the traditional type that
only counts the first one among a cited work's authors on the one hand and a non-traditional type that takes into
account the first 5 authors of a cited work on the other hand. Results indicate that the picture produced through this non-traditional author co-citation counting contains more coherent author groups and is therefore considerably clearer. However, this picture represents fewer specialties in the research field being studied than that produced through the traditional first-author co-citation counting when the same number of top-ranked authors is selected and analyzed. Reasons for these effects are discussed
Variations on the Author
“Variations on the Author” discusses two of Eduardo Coutinho’s recent films (Um Dia na Vida, from 2010, and Últimas Conversas, posthumously released in 2015) and their contribution to the general question of documentary authorship. The director’s filmography is characterized by a consistent yet self-effacing form of authorial self-inscription: Coutinho often features as an interviewer that rather than express opinions propels discourses; an interviewer that is good at listening. This mode of self-inscription characterizes him as an author who is not expressive but who is nonetheless markedly present on the screen. In Um Dia na Vida, however, Coutinho is completely absent form the image, while Últimas Conversas, on the contrary, includes a confessional prologue that moves the director from the margins to the center of his films. This article examines the ways in which these works stand out in the filmography of a director who offers new insights into the notion of cinematic authorship
Appropriate Similarity Measures for Author Cocitation Analysis
We provide a number of new insights into the methodological discussion about author cocitation analysis. We first argue that the use of the Pearson correlation for measuring the similarity between authors’ cocitation profiles is not very satisfactory. We then discuss what kind of similarity measures may be used as an alternative to the Pearson correlation. We consider three similarity measures in particular. One is the well-known cosine. The other two similarity measures have not been used before in the bibliometric literature. Finally, we show by means of an example that our findings have a high practical relevance.information science;Pearson correlation;cosine;similarity measure;author cocitation analysis
Dispelling the Myths Behind First-author Citation Counts
We conducted a full-scale evaluative citation analysis study of scholars in the XML research field to explore just how different from each other author rankings resulting from different citation counting methods actually are, and to demonstrate the capability of emerging data and tools on the Web in supporting more realistic citation counting methods. Our results contest some common arguments for the continued
use of first-author citation counts in the evaluation of scholars, such as high correlations between author rankings by first-author citation counts and other citation
counting methods, and high costs of using more realistic citation counting methods that are not well-supported by the ISI databases. It is argued that increasingly available digital full text research papers make it possible for citation analysis studies to go beyond what the ISI databases have directly supported and to employ more
sophisticated methods
koamabayili/VECTRON-author-checklist: VECTRON author checklist
We have done our best to complete the author checklist relating to the use of animals in the hut study. Note that the objective for the hut study was to evaluate the IRS treatment applications for residual efficacy against Anopheles mosquitoes, including the local An. coluzzii mosquito population. Cows were only used to attract mosquitoes into the huts and no tests were carried out directly on the cows. The author checklist is intended for use with studies where experiments are carried out on animals, which is why we have had such difficulty in completing this for the hut study, as many of the questions do not relate to how the cows were used
- …
