323,137 research outputs found
Efeito de extratos de Chenopodium ambrosioides sobre Sclerotium rolfsii.
No full textIn vitro, extrato etanólico de C. ambrosioides inibiu o crescimento micelial e a germinacao de esclerodios de S. rolfsii (fungo patogênico de raízes). A porcentagem de sobrevivência de escleródios foi de zero quando tratadas ate diluições de 1:100 (v/v). Extrato bruto de C. ambrosioides dissolvido em etanol foi aplicado em placas de cromatografia em camada delgada preparativa (CCD) obtendo-se cinco frações sendo que duas das quais apresentaram excelente atividade inibitória frente ao S. rolfsii. Essas frações ativas foram submetidas a coluna de Sephadex LH-20 para a separação e purificação dos compostos onde se obteve diversas frações que foram novamente avaliadas quanto a atividade. Dessas frações, sete mostraram atividade inibitória em relação ao crescimento micelial do S. rolfsii. A purificação e identificação dessas frações estão sendo realizadas na tentativa de identificar o principio ativo
Avaliação da eficiência do teste imunocromatográfico POC-CCA no diagnóstico da schistosomose em Moçambique Natália Ferracini
No full textResumo: A schistosomose é um problema de saúde pública e uma das Doenças Tropicais Negligenciadas mais importantes do mundo, atinge cerca de 240 milhões de pessoas e mais de 700 milhões vivem em áreas endémicas. É uma infeção parasitária, potencialmente crónica causada pelos platelmintas do género Schistosoma; a transmissão ao Homem ocorre através da água doce contaminada com as formas parasitárias (cercárias), que são libertadas pelo molusco, hospedeiro intermediário, infetado, e penetram no ser humano que entra em contacto com estes cursos de água. As espécies mais relevantes na África subsaariana são Schistosoma haematobium, que causa a schistosomose urogenital e Schistosoma mansoni, que causa a forma intestinal. Técnicas precisas de diagnóstico são importantes para uma determinação exata da prevalência da doença, para uma avaliação de programas de controlo e eliminação do parasita. De acordo com a OMS, o método de diagnóstico padrão é o exame parasitológico Kato-Katz (KK) para schistosomose intestinal e filtração da urina para a urogenital, no entanto, estes métodos não apresentam boa sensibilidade para áreas de baixa prevalência. Contudo, o teste imunocromatográfico POC-CCA deteta antigénios circulantes regurgitados por parasitas adultos e o seu formato como teste rápido apresenta algumas vantagens adicionais sobre as técnicas parasitológicas tradicionais, como a facilidade de uso e operação e o curto período de tempo necessário para o teste. No entanto, alguns problemas permanecem, incluindo a ocorrência de resultados falsos negativos, baixa sensibilidade e dificuldade de interpretação das leituras nomeadas como trace. Perante a necessidade de diagnóstico específico e sensível, a fim de detetar pequenas cargas parasitárias, esta tese tem como finalidade avaliar a sensibilidade do teste rápido POC-CCA na urina e fezes, tendo como referência a técnica de PCR, em amostras coletadas no distrito do Chókwè em Moçambique, área endémica para schistosomose. Foram incluídos 1033 indivíduos com uma idade média de 37,6 anos, sendo 28,3% do sexo masculino e 71,7% do sexo feminino. Foram coletadas 1033 amostras de urina para a avaliação de S. haematobium e 922 amostras de fezes para S. mansoni. A extração do DNA genómico foi realizada com o kit Speed Tools Tissue DNA. Para o PCR foi utilizado um par de primers específico para S. haematobium, ShF 5’AGTCGTGTCGATTTTAAGAC3’ e ShR
5’CCAACCATAAACATATGATG3’originando um fragmento de 365 pb, e um par de primers específico para S. mansoni, SmF 5’GAGATCAAGTGTGACAGTTTTGC3’ e SmR 5’ACAGTGCGCGCGTCGTAAGC3’ amplificando um fragmento de 350 pb. Os resultados para S. haematobium apresentaram uma maior prevalência no PCR, 10% (103/1033), e no método parasitológico e POC-CCA, apresentam respetivamente, 3,7% (38/1033) e 8,3% (86/1033). Não houve concordância entre POC-CCA e as demais técnicas (Kappa0,3). Para S. mansoni, apesar do Kato-Katz ter sido positivo para apenas duas amostras, para PCR a prevalência foi de 5,5% (51/922), enquanto para POC-CCA foi de 8,5% (78/922), contudo, a concordância entre os métodos manteve-se sem significado estatístico (Kappa<0). Em conclusão, o POC-CCA não parece ser um método eficaz para áreas de baixa endemicidade e para o controlo pós-terapêutico da schistosomose, sendo necessário investir no seu aperfeiçoamento e, se possível, uma combinação de métodos deva ser implementada em áreas endémicas.Abstract: Schistosomiasis is a public health problem and one of the most important Neglected Tropical Diseases in the world, affecting about 240 million people and more than 700 million living in endemic areas. It is a potentially chronic parasitic infection caused by flatworms of the genus Schistosoma; transmission to humans occurs through fresh water contaminated with parasitic forms (cercariae), which are released by the freshwater snail, an intermediate infected host, and penetrate human beings who come into contact with these watercourses. The most relevant species in sub-Saharan Africa are Schistosoma haematobium, which causes urogenital schistosomiasis, and Schistosoma mansoni, which causes intestinal schistosomiasis. Precise diagnostic techniques are important for an accurate determination of disease prevalence, for an evaluation of a parasite control and elimination programs. According to WHO, the standard diagnostic method is the Kato-Katz (KK) for intestinal schistosomiasis and urine filtration for the urogenital form, however, these methods lack good sensitivity for low prevalence areas. However, the POC-CCA immunochromatographic test detects circulating antigens regurgitated by adult parasites and its format as a rapid test has some additional advantages over traditional parasitological techniques, such as easier to use and operation and the short time required for the test. However, some problems remain, including the occurrence of false negative results, low sensitivity and difficulty in interpreting readings named as trace. Given the need for specific and sensitive diagnosis, in order to detect small parasitic loads, this thesis aims to assess the sensitivity of the rapid POC-CCA test in urine and stool, using the PCR technique as a reference, in samples collected in the district of Chókwè in Mozambique, an endemic area for schistosomiasis. A total of 1033 individuals were included with a mean age of 37.6 years, 28.3% male and 71.7% female. 1033 urine samples were collected for the evaluation of S. haematobium and 922 stool samples for S. mansoni. Genomic DNA extraction was performed with the Speed Tools Tissue DNA kit. For the PCR, specific primers for S. haematobium, ShF 5'AGTCGTGTCGATTTTAAGAC3' and ShR 5'CCAACCATAAACATATGATG3' and for S. mansoni, SmF 5'GAGATCAAGTGTGACAGTTTTGC3' and SmR 5'ACAGTGCGCGCGTCGTAAGC3'
were used, originating 365 bp and 350 bp amplicons respectively. The results for S. haematobium showed a higher prevalence in PCR, 10% (103/1033), and in the parasitological method and POC-CCA, they presented, respectively, 3.7% (38/1033) and 8.3% (86/1033). The observed agreement between POC-CCA and the other techniques was not significant (Kappa0.3). Although, the Kato-Katz technique was positive only for two samples, the prevalence with PCR technique was 5.5% (51/922), while for POC- CCA it was 8.5% (78/922). However, the agreement between these methods remained insignificant (Kappa<0,3). In conclusion, the POC-CCA seems to be an inefficient method for areas of low endemicity and for the post-therapeutic control of schistosomiasis, therefore it is necessary to invest in its improvement and, if possible, a combination of methods should be implemented in endemic areas
IMMUNOLOGICAL DETECTION OF PROTEINS PHOSPHORYLATED AT TYROSINE IN CELLS STIMULATED BY GROWTH-FACTORS OR TRANSFORMED BY RETROVIRAL-ONCOGENE-CODED TYROSINE KINASES
No full textThe receptors for polypeptide growth factors and proteins coded by oncogenes of the src family are endowed with protein kinase activity and share the uncommon property of autophosphorylating at tyrosine residues. It is unclear whether the tyrosine kinase activity is also directed towards other targets of physiological significance. In this work, phosphotyrosine antibodies were used to detect, by Western blots and immunoprecipitation, proteins phosphorylated at tyrosine in fibroblasts either stimulated by growth factors (PDGF and EGF) or transformed by oncogene-coded tyrosine kinases. In stimulated cells the antibodies detected the autophosphorylated receptors, but only trace amounts of other proteins phosophorylated at tyrosine. In fibroblasts transformed by retroviral oncogenes (v-src, v-abl, v-fps or v-fes) proteins other than the corresponding oncogene-coded kinase, were found. A p70 was found to be heavily phosphorylated in fibroblasts transformed by v-src, v-fes and v-fps. A p130 and a p36 were found in cells transformed by v-src and v-abl. A unique p70 was phosphorylated in v-abl-transformed fibroblasts. These proteins were also phosphorylated in vitro in an immunocomplex kinase reaction. This reaction was blocked by the specific kinase inhibitors. These data strongly suggest that tyrosine kinases phosphorylate protein targets other than themselves. These targets are barely detectable in normal cells stimulated by growth factors, where the kinase activity is triggered rapidly and transiently. By contrast, a number of intracellular proteins phosphorylated at tyrosine accumulate in cells transformed by v-onc-coded kinases, endowed with constitutive and non-regulated enzymatic activity
Epigenetics in Knee Osteoarthritis: A 2020–2023 Update Systematic Review
No full textOsteoarthritis is a leading cause of disability in the world. The scientific literature highlights the critical importance of epigenetic regulatory effects, intertwined with biomechanical and biochemical peculiar conditions within each musculoskeletal district. While the contribution of genetic and epigenetic factors to knee OA is well-recognized, their precise role in disease management remains an area of active research. Such a field is particularly heterogeneous, calling for regular analysis and summarizing of the data that constantly emerge in the scientific literature, often sparse and scant of integration. The aim of this study was to systematically identify and synthesize all new evidence that emerged in human and animal model studies published between 2020 and 2023. This was necessary because, to the best of our knowledge, articles published before 2019 (and partly 2020) had already been included in systematic reviews that allowed to identify the ones concerning the knee joint. The review was carried out in accordance with Preferential Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Only peer-reviewed articles were considered for inclusion. A total of 40 studies were identified, showing promising results in terms either of biomarker identification, new insight in mechanism of action or potential therapeutic targets for knee OA. DNA methylation, histone modification and ncRNA were all mechanisms involved in epigenetic regulation of the knee. Most recent evidence suggests that epigenetics is a most promising field with the long-term goal of improving understanding and management of knee OA, but a variety of research approaches need greater consolidation
P145, A PROTEIN WITH ASSOCIATED TYROSINE KINASE-ACTIVITY IN A HUMAN GASTRIC-CARCINOMA CELL-LINE
No full text
Diffusive author(s), cohesive author: Analysis of S/N (1994)
No full textThis study indicates the ways in which various aspects of the author(s) are brought forth in Dumb type’s performance art, the S/N production. Previous research has suggested a non-hierarchical organization of Dumb type and the absence of a “privileged author” in Dumb type’s collaborative work, S/N. However, the results that I have investigated from member’s interviews on the creative process of S/N along with my analysis of the recorded images of S/N, indicate a different aspect of the author(s). First, S/N was created through, so to speak, the collective ideas of the members of Dumb type. Further, S/N has at least nine quotations from previous performances, installations, and printed writings, besides the work-in-progress technique. Explicating one of the “author functions” as given by Michel Foucault, each text has plural subjects of the author. However, it has been revealed from members’ interviews that Teiji Furuhashi had a decision-making role in selecting the members’ ideas within the performance. Since then, S/N has had plural subjects of creation; however, Furuhashi is one of the subjects of creation along with the “privileged author.” S/N has plural authors (diffusive authors) yet at the same time, it has a “privileged author,” Teiji Furuhashi (cohesive author)
Going Beyond Counting First Authors in Author Co-citation Analysis
No full textThe present study examines one of the fundamental aspects of author co-citation analysis (ACA) - the way co-citation
counts are defined. Co-citation counting provides the data on which all subsequent statistical analyses and mappings
are based, and we compare ACA results based on two different types of co-citation counting - the traditional type that
only counts the first one among a cited work's authors on the one hand and a non-traditional type that takes into
account the first 5 authors of a cited work on the other hand. Results indicate that the picture produced through this non-traditional author co-citation counting contains more coherent author groups and is therefore considerably clearer. However, this picture represents fewer specialties in the research field being studied than that produced through the traditional first-author co-citation counting when the same number of top-ranked authors is selected and analyzed. Reasons for these effects are discussed
Influência de extratos vegetais no controle de fungos.
No full text"In vitro" foi avaliado o potencial de extratos vegetais de dez diferentes plantas, em diferentes solventes, como inibidores do crescimento micelial de Fusarium moniliforme, Rhizoctonia solani e Sclerotinia sclerotiorum. Para os testes foram utilizados discos de papel de filtro, de 5 mm de diâmetro, embebidos nos extratos e colocados, em numero de três, em placas de Petri com meio de BDA. Um disco de 6mm de diâmetro, contendo micélio dos fungos, foi colocado no centro de cada placa. A partir de dois dias de incubação, a 24 .C, foi feita a avaliação, observando-se o halo de inibicao do crescimento micelial ao redor dos discos com os extratos. Os extratos que apresentaram os melhores resultados foram: Quassia sp. (folha), metanólico, em F. moniliforme e R. solani; Simaba cedron (raiz), metanolico e aquoso em S. sclerotiorum; Simaruba amara (Folhas), acetônico, em R. solani, S. sclerotiorum; Simaruba amara (raiz), acetônico, também em R. solani; Pteurocaulon balansae (parte aerea), metanolico e em acetato de etila, tanto em F. moniliforme como em R. solani e S. sclerotiorum. Os extratos que se mostraram promissores, quanto a atividade fungicida, estão sendo fracionados e as frações avaliadas a fim de se identificar o principio ativo. Também estão sendo avaliados quanto a seus efeitos sobre a germinação de sementes de milho e feijão inoculados com F. miniliforme e R. solani, respectivamente
- …
