1,731,777 research outputs found
Kolla brevis Feng & Zhang, sp. nov.
Kolla brevis Feng & Zhang sp. nov. (Figs. 1 E–H, 3A–I) Material examined. Holotype: ♂, China, Xizang Autonomous Region (Tibet), Linzhi, Bomi, Bolonggong, 80K, 15 June 2015, coll. Zhai Qing with Malaise trap. Paratype: 1♂, same data as holotype. Measurement. Length of male 6.8–7.0 mm. Description of male. Crown yellow to brown, with large irregular black median spot between ocelli; face yellow with obvious clypeal muscle impressions, the inverted triangle black marking almost covering all the postclypeus, anteclypeus with a small light brown spot; pronotum black without any spots; scutellum black with small brown to yellow apex; forewing black except extraordinarily narrow transparent yellow stripe next to costal margin, with the apex membranous transparent. Male pygofer side moderately produced posteriorly, slightly shorter than plate, with macrosetae evenly distributed on half of posterior and dorsal margin; each process following ventral margin of pygofer, then curving posterodorsad, with a group of microsetae in base. Connective arms and long manubrium surrounded by membrane; style wide and membranous at base, then currently acute at apex; plate subtriangular, with inner margin obviously concave near midlength, with a large amount of stubby microsetae in inner margin, with 2 rows of macrosetae distributed near median of the plate, outside row of macrosetae short, median row of macrosetae long, along the outer margin covered with microsetae; aedeagus bent anterodorsad in lateral view, shaft with a pair of lobes widely divergent, with a protuberance reaching the 2/3 of two lobes in caudoventral view. Etymology. This new specific epithet is the Latin word “ brevis ”, referring to the aedeagal protuberance being much shorter than lobe. Female. Unknown. Distribution. China (Xizang Autonomous Region). Molecular Characters. Partial mitochondrial COI gene sequence with GenBank accession number: KX498029. Material: 1♂, China, Xizang Autonomous Region, Linzhi, Bomi, Bolonggong, 80K, 15 June 2015, coll. Zhai Qing and Wang Baohai. The gene sequence is as follows: TACAATGTATTTTATATTTGGTATCTGGGCGGGGATAATTGGTACTATACTAAGAATAATTATTCGTGTCG AATTAGCACAACCAGGATCATTTTTAGGTAACGATCAATTATATAATGTAATTGTTACTTCTCATGCATTT ATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTCGGTAATTGATTACTCCCTTTAATAATT GGTGCGCCAGACATAGCATTTCCACGGATAAACAATATAAGATTTTGGATACTGCCCCCCTCTATAGTT TTATTACTCGTTAGATCTTTAGTTGAATCAGGAGCAGGTACAGGCTGAACAGTTTACCCTCCCCTATCT GGGAATATCGCTCACTCAGGGGCTAGAGTAGACTTAACAATTTTTTCTCTTCACTTGGCTGGAATTTCA TCTATCTTAGGGGCAGTAAATTTTATTACTACGGTAATTAACATGCGAACAACTGGAATAAATTTGGATC GAACTCCATTATTTGTTTGGTCAGTAATAATTACGGCTGTACTTTTGCTTCTTTCTCTACCAGTTTTGGC TGGAGCAATTACAATATTATTAACAGACCGAAATATTAATACTAGTTTTTTTG Remarks. This new species is very similar to K. atramentaria (Motschulsky, 1859), but it can be distinguished by the following characters: crown with large black median spot between ocelli (Figs 1 E, 1G); pygofer process curved dorsad before apex in lateral view (Figs 3 A, 3C, 3E); aedeagus shaft with a pair of lobes widely divergent, with a protuberance, reaching the 2/3 of the lobes, between two lobes in caudoventral view (Figs 3 H, 3I). This species is also very similar to K. procerula Feng & Zhang, 2015, but can be easily differentiated from the latter by: crown with large irregular black median spot between ocelli (Figs 1 E, 1G); face with an inverted triangular black marking occupying most of postclypeus (Fig. 1 H); pygofer process curving posterodorsad (Figs 3 A, 3C, 3E); plate with multiseriate macrosetae (Figs 3 B, 3D); aedeagus shaft with a pair of widely divergent lobes and protuberance reaching 2/3 length of two lobes in caudoventral view (Figs 3 H, 3I).Published as part of Feng, Ling & Zhang, Yalin, 2017, Two new species in the genus Kolla Distant (Hemiptera: Cicadellidae: Cicadellinae) from China, with DNA barcoding data, pp. 191-197 in Zootaxa 4250 (2) on pages 195-196, DOI: 10.11646/zootaxa.4250.2.5, http://zenodo.org/record/45278
Kolla procerula Feng & Zhang, sp. nov.
Kolla procerula Feng & Zhang sp. nov. (Figs. 1 I–L, 4 A–H) Description. Crown with large median semicircular black spot touching basal margin, apical margin with pair of large black submedial maculae and small median black spot; face dark yellow with distinct clypeal muscle impressions; pronotum and scutellum black except small apical area of scutellum yellow; forewing black except for narrow transparent yellow stripe along costal margin. Male pygofer with a group of macrosetae located posterodorsally and evenly distributed microsetae on disk; ventral process with fine microsetae distributed evenly on basal half, distal half slender, twisted, extending slightly beyond pygofer apex; plates each with inner margin slightly concave near midlength, outer margin oblique, with uniseriate macrosetae and densely covered by long fine setae; aedeagus evenly curved dorsad in lateral view, shaft with lobes small and acute in lateral view, with short protuberance between them in caudoventral view. Measurement. Length of male 5.4–5.6 mm. Material examined. Holotype: ♂, China, Hebei Province, Weixian, 20 June 2009, coll. Qin Daozheng; Paratypes: 1 ♂, China, Ningxia Hui Autonomous Region, Liupanshan Mountain, 22 June 2008, coll. Meng Qiulei; 1 ♂, China, Gansu Province, Xinglong Mountain Nature Reserve, 27 July 2012, coll. Xue Qingquan. Remarks. This species is similar to K. atramentaria (Motschulsky, 1859), but can be easily distinguished from the latter by the different color pattern, less strongly produced head (Figs 1 I- 1 L), male plates densely covered by long fine setae (Figs 4 A, 4 B), and aedeagal shaft with lobes small and acute with a short protuberance between them (Fig. 4 G). Etymology. This new specific epithet is derived from the Latin word “procerulus”, referring to the short protuberance between two aedeagal shaft lobes.Published as part of Feng, Ling & Zhang, Yalin, 2015, Leafhopper genus Kolla Distant (Hemiptera: Cicadellidae: Cicadellinae) with descriptions of four new species from China, pp. 430-438 in Zootaxa 3999 (3) on pages 435-436, DOI: 10.11646/zootaxa.3999.3.8, http://zenodo.org/record/23624
Atkinsoniella valida Feng & Zhang, sp. nov.
Atkinsoniella valida Feng & Zhang sp. nov. (Figs. 1 E–H, 3) Description. Crown, anterior portion of pronotum and scutellum whitish gray in dorsal view, ocelli whitetransparent without narrow border; a small black spot at apex of head, but without a median spot bordering basal margin; pronotum without spot; in ventral view; abdomen dull orange; forewing whitish gray near base, remainder of forewing dull orange; face whitish gray with a very small median black spot located in the basal part of clypeus; legs dull orange. Head moderately produced with anterior margin broadly rounded in dorsal view; ocelli located in concavities and on line between anterior eyes, crown convex between ocelli; lateral clypeal sutures extending onto crown but not attaining ocelli; clypeus flattened medially with muscle impressions weak; pronotum slightly convex and width almost equal to crown, disk dorsum without sculpture, with anterior margin convex and posterior slightly concave in the median; scutellum convex before and behind transverse depression; forewing with four apical cells, base of the second and third cells almost aligned transversely. Male abdominal second sternal apodemes extending beyond first conjunctiva behind their origin. Male pygofer produced posteriorly, posterior margin narrowed, with macrosetae on posterior portion; pygofer processes arising basiventrally on each side, with macrosetae at base, extending posterioventrally, apex acute, without small dentate near subapically; plates with macrosetae uniseriate, with long microsetae near lateral margin and entire ventral surface in apical half; connective ‘Y’- shaped, extending posteriorly father than midlength of style but not as far as style apex; style slender, preapically curved and apically acute; aedeagus wide at base only slightly narrowed anteapically and dorsal margin undulate in lateral view; paraphysis stubbed, longer than aedeagus, preapically curved and apically acute. Measurement. Length of male 7.2–7.5 mm. Material examined. Holotype: ♂, China, Hainan Province, Jianfengling, 5 June 2007, coll. Duan Yani; Paratypes: 4 ♂♂, same data as holotype. Remarks. This species is very similar to A. cyclops (Melichar, 1914), but it differs from the latter in having the aedeagus with dorsal margin undulate and paraphyses stubby. It is also similar to A. thalia (Distant, 1918) but has the pygofer almost straight at apex with processes lacking small denticulae subapically; the paraphysis stubby and the aedeagus wide and long, only slightly narrowed anteapically. Etymology. This new specific epithet is derived from the Latin word “validus”, referring to the stubby paraphysis.Published as part of Feng, Ling & Zhang, Yalin, 2015, The leafhopper genus Atkinsoniella Distant (Hemiptera: Cicadellidae: Cicadellinae) with descriptions of two new species from China, pp. 274-286 in Zootaxa 4028 (2) on pages 283-285, DOI: 10.11646/zootaxa.4028.2.7, http://zenodo.org/record/23675
Kolla prolongata Feng & Zhang, sp. nov.
Kolla prolongata Feng & Zhang sp. nov. (Figs. 1 E–H, 3 A–H) Description. Crown with diffuse black cruciform marking between ocelli, pair of transverse black submedial maculae and small median black spot on anterior margin; face yellow without obvious clypeal muscle impressions; posterior half of pronotum black with black rounded lobe extended into anterior half medially; scutellum orange with basal triangles and median posterior macula black; forewing black except narrow transparent yellow stripe along costal margin. Male pygofer with macrosetae posteriorly and evenly distributed microsetae; ventral process with fine setae at base, nearly straight and evenly tapered for most of length, abruptly curved dorsad before apex of pygofer; plates each with inner margin obviously concave near midlength, outer margin almost oblique, with several microsetae in base, with uniseriate macrosetae along the side of its outer margin; aedeagus bent dorsad in lateral view, shaft with lobes relatively narrow, widely divergent, without dorsal projection; base of aedeagal shaft elongated in lateral view, without protuberance between two lobes in caudoventral view. Measurement. Length of male 6.1–6.2 mm. Material examined Holotype: ♂, China, Zhejiang Province, Qingliangfeng Nature Reserve, 11 August 2011, coll. Wang Yang; Paratypes: 1 ♂, China, Hainan Province, Jianfengling, 20 July 2009, coll. Gao Xia; 1 ♂, China, Guangxi Province, Guilin, 28 August 1974, coll. Chou Io; 1 ♂, China, Zhejiang Province, Qingliangfeng Nature Reserve, 6 August 2008, coll. Gao Xia. Remarks. The new species is very similar to K. paulula (Walker, 1858), but can be easily distinguished from the latter by the following differences: crown with diffuse black cruciform marking between ocelli (Fig. 1), scutellum with basal triangles and median posterior macula black (Figs 1 E, 1 G), plates each with inner margin obviously concave near midlength (Fig 3 B), base of aedeagal shaft elongated (Fig. 3 H). It is also similar to K. rhabdoma Yang & Li, 2000 but differs from the latter by the markings on the crown and thorax in dorsal view and on the face; and the shape of its aedeagus and subgenital plate. Etymology. This new specific epithet is derived from Latin word “prolongatus”, referring to the base of the aedeagal shaft being elongated.Published as part of Feng, Ling & Zhang, Yalin, 2015, Leafhopper genus Kolla Distant (Hemiptera: Cicadellidae: Cicadellinae) with descriptions of four new species from China, pp. 430-438 in Zootaxa 3999 (3) on pages 433-434, DOI: 10.11646/zootaxa.3999.3.8, http://zenodo.org/record/23624
Kolla emphysematosa Feng & Zhang, sp. nov.
Kolla emphysematosa Feng & Zhang sp. nov. (Figs. 1 A–D, 2 A–H) Description. Crown with small round black spot corresponding to each ocellus, coronal suture black, pair of transverse black submedial maculae on anterior margin and small black spot at apex of head; face yellow with distinct clypeal muscle impressions and longitudinal brownish spot on anteclypeus; pronotum with black anterior transverse band interrupted by median oval pale spot, pair of small black sublateral maculae at midlenght, midline and broad posterior transverse band black; scutellum orange with basolateral triangles black; forewing black except for narrow transparent yellow stripe along costal margin and narrowly yellow commissural margin of clavus. Male pygofer with macrosetae located posterodorsally and dense microsetae near middle of disk; ventral process with group of stubby microsetae at base, abruptly narrowed near midlength, then becoming slender with acute apex in lateral view, curved posteromesad; plates concave near midlength of outer margin, inner margin almost straight, with uniseriate macrosetae and scattered microsetae. Aedeagus bent dorsad in lateral view, lobes of shaft broadly rounded with acute dorsal projection, aedeagal shaft wide basally in lateral view, without protuberance between two lobes in caudoventral view. Measurement. Length of male 5.5–5.7mm Material examined. Holotype: ♂, China, Sichuan Province, Batang, 11 July 2001, coll. Sun Qiang; Paratype: 1 ♂, same data as holotype but with light trap. Remarks. This species is similar to K. lunulata Li & Wang, 1991, but can be easily distinguished from the latter by the following differences: anteclypeus with longitudinal brownish spot (Fig. 1 D), pronotum with pair of small black sublateral maculae at midlength (Fig. 1 C), pygofer posterior margin smoothly convex (Fig. 2 A), and processes abruptly narrowed near midlength (Fig. 2 D), connective‘Y’- shaped with inflated manubrium near midlength (Fig. 2 E), and apex of aedeagus not significantly hooked (Figs 2 G, 2 H). Etymology. This new specific epithet is derived from Latin word “emphysematosus” referring to the wide base of the aedeagal shaft.Published as part of Feng, Ling & Zhang, Yalin, 2015, Leafhopper genus Kolla Distant (Hemiptera: Cicadellidae: Cicadellinae) with descriptions of four new species from China, pp. 430-438 in Zootaxa 3999 (3) on page 432, DOI: 10.11646/zootaxa.3999.3.8, http://zenodo.org/record/23624
Kolla medsimilis Feng & Zhang, sp. nov.
Kolla medsimilis Feng & Zhang sp. nov. (Figs. 1 A–D, 2A–H) Material examined. Holotype: ♂, China, Xizang Autonomous Region (Tibet), Linzhi, Bomi, Bolonggong, 80K, 15 June 2015, coll. by Zhai Qing with Malaise trap; Paratype: 1 ♂, same data as holotype. Measurement. Length of male 6.3–6.5mm Description of male. Crown pale yellow, anterior margin broadly round, with extremely large irregular black medial marking and extending to face; face pale yellow, anterior margin with pair of black spots and small median spot, clypeal muscle impressions indistinct, postclypeus with rectangular black medial spot, anteclypeus with small irregular black marking; pronotum black with narrow transverse wavy pale yellow line near anterior margin; scutellum black with a V-shaped pale yellow spot at apex; forewing black except for exceedingly narrow transparent stripe next to costal margin. Male pygofer side not strongly produced posteriorly, significantly shorter than plate, posterior margin broadly convex, with group of macrosetae on apical half of disk and dense microsetae on upper base of disk; ventral process arising basiventrally and extending posterodorsad, wide at base with group of stubby microsetae, gradually narrowing toward middle part, then becoming slender with dentate acute apex in lateral view. Connective center of arms and around apex of manubrium membranous; style wide with the base membranous, then acute at apex; plates subtriangular, longer than pygofer, both margins gently concave near midlength, with two columns of macrosetae at base and scattered microsetae. Aedeagus bent anterodorsad in lateral view, shaft with a pair of lobes, inner side of the lobe almost straight, outer side of the lobe significantly concave near midlength, inner side of apex of lobes slightly sclerotized, with protuberance, as long as lobes, between two lobes in caudoventral view. Etymology. This new specific epithet is a combination of Latin words “med-” and “similis” referring to the aedeagal protuberance being as long as two lobes. Female. Unknown. Distribution. China (Xizang). Molecular characters. Partial mitochondrial gene COI sequence with GenBank accession number: KX498028. Material: 1♂, China, Xizang Autonomous Region, Linzhi, Bomi, Bolonggong, 80K, 15 June 2015, coll. Zhai Qing, Wang Baohai. The sequence is as follows: CACAATGTATTTTATATTTGGTATCTGGGCAGGGATAATTGGCACAATACTAAGAATAATTATTCGTGTT GAATTAGCACAGCCTGGATCATTTTTAGGTAACGATCAATTATACAATGTAATTGTTACTTCTCATGCAT TTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGTTTTGGTAATTGATTACTACCCCTTATAAT CGGTGCACCAGATATAGCATTTCCACGTATAAATAATATAAGATTTTGAATATTACCTCCCTCTATAGTTT TGTTGTTAGTTAGATCTCTTGTTGAATCAGGAGCAGGAACAGGTTGAACAGTTTACCCACCTCTATCTG GGAATATTGCTCATTCAGGAGCTAGAGTCGATTTAACAATCTTTTCCCTCCACTTGGCTGGAATTTCAT CCATCTTGGGGGCAGTTAATTTTATTACTACAGTAATTAATATACGAACAACTGGTATAAATTTGGATCG AACCCCCTTATTTGTTTGGTCAGTTATAATCACAGCTGTACTTTTACTTCTTTCCCTACCTGTTTTAGCA GGAGCAATCACAATATTATTAACAGACCGAAATATTAATACTAGTTTTTTTG Remarks. This new species is similar to Kolla nigrifascia Yang & Li, 2000, but it can be easily distinguished by the following characters: crown with extremely large irregular black spot covering almost the whole crown (Figs 1 A, 1C); male pygofer with posterior margin broadly convex, with a group of macrosetae on apical half of disk and dense microsetae scattering on upper base of disk (Figs 2 A, 2C); aedeagal shaft with pair of lobes, inner side of lobe almost straight, outside of lobe significantly concave near midlength, apex of lobes slightly sclerotized, with protuberance as long as lobes in caudoventral view (Figs 2 H, 2I). This new species is also similar to Kolla fusciosigna Yang & Li, 2002, but it differs from the latter by the markings of the crown and face (Figs 1 A, 1C, 1D); the broadly convex male pygofer posterior margin, with several macrosetae on the apical half and ventral and upper base of disk (Figs 2 A, 2C); and the apex of the aedeagal lobes poorly sclerotized (Figs 2 H, 2I). The DNA barcode sequences for this and the species described below are the first barcode data for the genus Kolla submitted to GenBank.Published as part of Feng, Ling & Zhang, Yalin, 2017, Two new species in the genus Kolla Distant (Hemiptera: Cicadellidae: Cicadellinae) from China, with DNA barcoding data, pp. 191-197 in Zootaxa 4250 (2) on pages 192-195, DOI: 10.11646/zootaxa.4250.2.5, http://zenodo.org/record/45278
Supporting_information.docx – Supplemental material for A study on human serum albumin corona formed on photoluminescent carbon dots
Supplemental material, Supporting_information.docx for A study on human serum albumin corona formed on photoluminescent carbon dots by Peng Wang, Ming Yuan, Na Li and Feng Zhang in Journal of Chemical Research</p
Going Beyond Counting First Authors in Author Co-citation Analysis
The present study examines one of the fundamental aspects of author co-citation analysis (ACA) - the way co-citation
counts are defined. Co-citation counting provides the data on which all subsequent statistical analyses and mappings
are based, and we compare ACA results based on two different types of co-citation counting - the traditional type that
only counts the first one among a cited work's authors on the one hand and a non-traditional type that takes into
account the first 5 authors of a cited work on the other hand. Results indicate that the picture produced through this non-traditional author co-citation counting contains more coherent author groups and is therefore considerably clearer. However, this picture represents fewer specialties in the research field being studied than that produced through the traditional first-author co-citation counting when the same number of top-ranked authors is selected and analyzed. Reasons for these effects are discussed
Variations on the Author
“Variations on the Author” discusses two of Eduardo Coutinho’s recent films (Um Dia na Vida, from 2010, and Últimas Conversas, posthumously released in 2015) and their contribution to the general question of documentary authorship. The director’s filmography is characterized by a consistent yet self-effacing form of authorial self-inscription: Coutinho often features as an interviewer that rather than express opinions propels discourses; an interviewer that is good at listening. This mode of self-inscription characterizes him as an author who is not expressive but who is nonetheless markedly present on the screen. In Um Dia na Vida, however, Coutinho is completely absent form the image, while Últimas Conversas, on the contrary, includes a confessional prologue that moves the director from the margins to the center of his films. This article examines the ways in which these works stand out in the filmography of a director who offers new insights into the notion of cinematic authorship
- …
