1,721,004 research outputs found
Salmonella Rissen Φ1: a molecular switch
No full textIntroduction: Bacteria develop resistance against phages by losing the phage receptor or reducing its binding specificity or by a temporary change of phage receptor specificity. Here we describe the phage resistance mechanism adopted by S. Rissen which acts through a molecular switch.
Material & Methods: Phage was isolated from the S. Rissen strain (RW) and used to select the phage resistant strain RRφ1+. We evaluate both the differences in bacterial morphology and the genetic variations between the two strains by biochemical and comparative genomic analyses.
Results: Biochemical analyses showed that the presence of the phage influences biofilm production, phage resistance and the switch of the O-antigen from smooth to rough, Genomic analysis showed that the sensitive and resistant strains differ by 10 genes. Only the phosphomannomutase_1 and 2 genes, involved in mannose synthesis pathway, showed different expression levels. The SNP of the two genes are located near HTs known to regulate phase variation. We used S rissen to see whether a character under strong selection pressure- such as phage resistance is repeatable. In four independent experiment phage resistance was acquired by the same molecular mechanism.
Conclusion: S. rissen uses the same and evolutionary flexible tool (phase variation) to control several characters: biofilm production, phage resistance, and O-antigen structure
Going Beyond Counting First Authors in Author Co-citation Analysis
Get PDFThe present study examines one of the fundamental aspects of author co-citation analysis (ACA) - the way co-citation
counts are defined. Co-citation counting provides the data on which all subsequent statistical analyses and mappings
are based, and we compare ACA results based on two different types of co-citation counting - the traditional type that
only counts the first one among a cited work's authors on the one hand and a non-traditional type that takes into
account the first 5 authors of a cited work on the other hand. Results indicate that the picture produced through this non-traditional author co-citation counting contains more coherent author groups and is therefore considerably clearer. However, this picture represents fewer specialties in the research field being studied than that produced through the traditional first-author co-citation counting when the same number of top-ranked authors is selected and analyzed. Reasons for these effects are discussed
CSN1S1 and CSN1S2: Two Remarkable Examples of Genetically Modulated Alternative Splicing via Identification of Allele-Specific Splicing Events
No full textSplicing regulatory sequences are cornerstones for exon recognition. Mutations that modify
them can severely compromise mRNA maturation and protein production. A wide range
of mutations, including SNPs and InDels, can influence splicing regulatory signals either
directly (e.g., altering canonical donor and acceptor dinucleotides) or indirectly (e.g., creating
cryptic splice sites). CSN1S1 and CSN1S2 genes encode for the two main milk proteins,
αs1 and αs2 caseins, respectively. They represent a remarkable and unique example of the
possibilities for alternative splicing of individual genes, both due to the high number of
alternative splices identified to date and for recognized allele-specific splicing events. To
date, at least 13 alleles of CSN1S1 originating from mutations that affect canonical splice
sites have been described in Bos taurus (CSN1S1 A, A1, and H), Ovis aries (E, H, and I), Capra
hircus (D and G), Bubalus bubalis (E, F) and Camelidae (A, C, and D). Similarly, allele-specific
splicing events have been described at the CSN1S2 locus in B. taurus. (CSN1S2 D), C. hircus
(CSN1S2 D), B. bubalis (CSN1S2 B, B1, and B2), Equus asinus (CSN1S2 I B), and Camelidae.
This review highlights that mutations affecting canonical splice sites, particularly donor
sites, are significant sources of genetic variation impacting the casein production of the
main dairy livestock species. Currently, a key limitation on this topic is the lack of detailed
functional and proteomic studies. Future research should leverage advanced omics technologies
like long-read transcriptomics and allele-resolved RNA sequencing to characterize
these splicing mechanisms, guiding precision breeding strategies
Variations on the Author
Get PDF“Variations on the Author” discusses two of Eduardo Coutinho’s recent films (Um Dia na Vida, from 2010, and Últimas Conversas, posthumously released in 2015) and their contribution to the general question of documentary authorship. The director’s filmography is characterized by a consistent yet self-effacing form of authorial self-inscription: Coutinho often features as an interviewer that rather than express opinions propels discourses; an interviewer that is good at listening. This mode of self-inscription characterizes him as an author who is not expressive but who is nonetheless markedly present on the screen. In Um Dia na Vida, however, Coutinho is completely absent form the image, while Últimas Conversas, on the contrary, includes a confessional prologue that moves the director from the margins to the center of his films. This article examines the ways in which these works stand out in the filmography of a director who offers new insights into the notion of cinematic authorship
The interleukin-10 polymorphism g.3936 G>A is uncoupled with bovine tuberculosis susceptibility in water buffalo (Bubalus bubalis)
No full textMycobacterium bovis (Mb), the causing agent of bovine tuberculosis (bTB), is an intracellular
pathogen highly adapted to the host condition. In cattle, several studies regarding the influence of
host genetic makeup, have highlighted the influence of polymorphisms on progression and/or
resistance to bTB. For this reason, we decided to investigate the role of a pleiotropic immune
mediator, named interleukin-10 (IL-10) on susceptibility to bTB in water buffalo (Bubalus bubalis).
IL-10 is secreted by several kind of cells belonging to the innate immune response and is expressed
during TB infection. It is involved in phagosome maturation and in the regulation of pro14
inflammatory cytokine induction as well. These two aspects indicate that IL-10 gene play a critical
role in susceptibility and pathogenesis of bTB. To test our hypothesis, we extracted the DNA from
blood samples of 184 buffaloes (59 case and 125 controls) reared in 5 herds located in Campania
region (South Italy). A 300bp region spanning the exon 5 of the IL-10 gene (NW_005783511) in 10
cases and 10 controls chosen randomly was amplified and sequenced. Sequence comparisons
showed a transversion g.3936G>A responsible of the substitution p.Arg152Lys in the primary
protein sequence. To test the possibility that g.3936G>A polymorphism is a bTB associated marker
we genotyped all samples by mean of AS-PC
Appropriate Similarity Measures for Author Cocitation Analysis
Get PDFWe provide a number of new insights into the methodological discussion about author cocitation analysis. We first argue that the use of the Pearson correlation for measuring the similarity between authors’ cocitation profiles is not very satisfactory. We then discuss what kind of similarity measures may be used as an alternative to the Pearson correlation. We consider three similarity measures in particular. One is the well-known cosine. The other two similarity measures have not been used before in the bibliometric literature. Finally, we show by means of an example that our findings have a high practical relevance.information science;Pearson correlation;cosine;similarity measure;author cocitation analysis
Identification of a novel polymorphism in the 3’untraslated region of the interferon gamma gene as potential marker associate with bovine tuberculosis in water buffalo
No full textInterferon gamma (IFNG) is a pro-inflammatory cytokine produced by
different cells of the innate and adaptive immune system. It plays a critical
role orchestrating the immune response towards many pathogens including
virus and intracellular bacteria. Mycobacterium bovis, the causing agent of
bovine tuberculosis (bTB), is an intracellular bacteria that is phagocytized
by alveolar macrophages and stimulates production and secretion of IFNG.
It has been demonstrated that polymorphisms in the Ifng gene affect the
outcome of TB. For this reason, in this study we want to analyze the
genetic variability in the Ifng gene and how the susceptibility to bovine
tuberculosis in water buffalo (Bubalus bubalis) is influenced.
To test our hypothesis, we have collected 184 blood samples from 5
different water buffalo herds in the Campania region (South Italy).
Samples were first divided in cases (59 subjects) and controls (125
subjects) according to a previous study. We sequenced a fragment of 690
bp spanning the exon 4 of Ifng gene (NW_005783995.1) in 20 samples
chosen randomly. Alignment analysis show a nucleotide transversion at the
position g.4667G>A in the 3’ untraslated region (3’UTR). To verify if the
g.4667G>A could have any potential regulatory effect on IFNG expression,
we interrogated a software for prediction of microRNA (miR) binding site
(http://www.targetscan.org/vert_71/). MicroRNA (miR) are short noncoding
RNA that influence the gene expression targeting a seed sequence
mostly located the 3’UTR of a specific gene. Thus, we found that our
polymorphism belong to 5’ GGTTTTATCTCAGGGGCCAACTAGG 3’ that
includes the seed sequence of miR-125b (seed sequence is underlined and
the polymorphism g.4667G>A is highlighted in bold).
This preliminary finding is a good starting point for extending the analysis
of g.4667G>A to all 184 samples to verify if the polymorphism is
associated with resistance to bovine tuberculosis in water buffalo.
Moreover, functional in vitro studies will be performed to evaluate if the
binding of miR-125b is influenced by the g.4667G>A in water buffalo
Dispelling the Myths Behind First-author Citation Counts
Get PDFWe conducted a full-scale evaluative citation analysis study of scholars in the XML research field to explore just how different from each other author rankings resulting from different citation counting methods actually are, and to demonstrate the capability of emerging data and tools on the Web in supporting more realistic citation counting methods. Our results contest some common arguments for the continued
use of first-author citation counts in the evaluation of scholars, such as high correlations between author rankings by first-author citation counts and other citation
counting methods, and high costs of using more realistic citation counting methods that are not well-supported by the ISI databases. It is argued that increasingly available digital full text research papers make it possible for citation analysis studies to go beyond what the ISI databases have directly supported and to employ more
sophisticated methods
- …
