3,545 research outputs found
The Private Cost of Long-Term Care in Canada: Where You Live Matters
Canadians expect the same access to health care whether they are rich or poor, and wherever they live, often without direct charge at the point of service. However, we find that the private cost of long-term care differs greatly across the country, and within provinces, we find substantial variation, depending on income level, marital status, and, in Quebec alone, on assets owned. A non-married person with average income would pay more than twice as much in the Atlantic provinces as in Quebec, while a couple with one in care would pay almost four times as much in Newfoundland as in Alberta.long-term care, private cost
PROPOSE OF HDB FIRE LIFE SAFETY/ EVACUATION APPROACH
Bachelor'sBACHELOR OF SCIENCE (PROJECT AND FACILITIES MANAGEMENT
Review of Mayer, R.; Knothe, F.; Shuo, H. (2022) Reflected beauty: Chinese reverse glass paintings from the Mei Lin Collection
In this well-documented, bilingual, and richly illustrated catalogue, published for the long-anticipated exhibition Reflected Beauty: Chinese Reverse Glass Paintings from the Mei Lin Collection at the University Museum and Art Gallery of the University of Hong Kong (September 2021-January 2022), the authors give us a profound insight into the phenomenon of reverse painting on glass and mirror paintings, with a particular focus on those from the Mei Lin Collection assembled by the Sinologist, author, and translator Rupprecht Mayer and his wife Haitang Mayer-Liem. Composed of over one hundred works acquired in East Asia between 1968 and 2012, this is one of the world's most important collections of Chinese reverse glass paintings from the late nineteenth and twentieth centuries.Modern and Contemporary Studie
Tsounkranaglenea Lin & Ge 2021, gen. nov.
Tsounkranaglenea gen. nov. Type species: Tsounkranaglenea hefferni sp. nov. Diagnosis. It is mostly similar to Glenea by the lateral elytral carinae and truncate elytral apex, but can be distinguished by the elongated, bended and rake-shaped sternite VII. In fact, it differs from all other saperdine genera by the peculiar sternite VII in males. It also differs from Paraglenea Bates, 1866, Heteroglenea Gahan, 1897 (as defined in Lin, Montreuil et al, 2009) and Pareutetrapha Breuning, 1952 by the male claws of fore and hind legs simple instead of appendiculate or bifid and elytral apex truncated with sharp teeth instead of rounded or slightly truncated without sharp teeth. It also differs from Eumecocera Solsky, 1871 and Stenostola Dejean, 1835 by the elytra with lateral carinae and male claws of fore and hind legs simple instead of appendiculate or bifid. The combination of the following characters makes the new genus easily separable from other saperdine genera: prothorax without lateral tubercles, elytra with distinct lateral carinae, elytral apex truncated with long spines at outer angle, male claws with appendiculated tooth only in mesotarsi and female claws all simple, male sternite VII elongated and bended into a rake-shape. Description. Small-sized (under 15 mm). Head not broader than prothorax. Eyes deeply emarginate, not divided, lower eye lobe much vertically longer than (male) to subequal to (female) gena. Antennae longer than body, in male slightly longer than female, basal segments fringed with sparse setae, scape slightly expanded, second antennomere short, third antennomere always the longest, 4 th antennomere subequal to (female) to slightly longer than (male) scape, 4 th to 10 th slightly and gradually decreasing in length except 11 th being slightly longer than 10 th. Prothorax cylindrical, without lateral tubercles, slightly narrowed around basal fifth. Elytra subparallel, truncated apically, with sharp teeth at both inner and outer angles, each with two distinct lateral carinae starting from the base and combined into apical outer tooth (Figs 1b, 11b). Procoxal cavity closed posteriorly (Fig. 11c), mesocoxal cavity open to mesepimeron, metanepisternum more than twice as wide anteriorly as posteriorly. Protarsi with first segment expanded in male (Fig. 1a), mesotibiae with an oblique groove with setae (Fig. 1b), hind femur reaching fifth abdominal segment, hind tarsi with first segment longer than the following two combined. Male claws: only anterior claws of mesotarsi appendiculate with small teeth (Figs. 4–5), posterior claws of mesotarsi without teeth, and claws of pro- and metatarsi simple. Females claws simple (Figs. 11 a-11b). Male sternite VII elongated and bent into a rake-shape (Figs. 1–3), female sternite VII with a median groove (Fig. 11c). Male terminalia. Apex of male tergite VIII emarginated (Figs. 6a–6c). Lateral lobes slender, with a strong tooth at ventral base (Fig. 8b); ringed part elbowed in the widest portion, converging; basal piece well-developed and bifurcated (Fig. 8c). Median lobe strongly curved, shorter than tegmen, dorsal plate shorter than ventral plate, apex of ventral plate emarginated (Fig. 9a). Median foramen not elongated. Endophallus with one band of supporting armature, 4 basal plate-like sclerites, and 3 rod-like sclerites. Ejaculatory duct single. Female terminalia: Setae of sternite VIII dense and long. Spermathecal capsule and gland positioned on apex of spermathecal duct. Spermathecal capsule strongly sclerotized, composed of an apical orb and a long stalk, spiculum ventrale longer than abdomen. Etymology. The generic name is a combination of a Greek word tsounkrána (τσουγκράνα) and the genus name Glenea. The Greek word “tsounkrána” refers to the shape of sternite VII in male, which looks like a rake. Gender feminine. Distribution. Malaysia. Remarks. It is very similar to Glenea (Breuning, 1956; Breuning, 1958) by the elytral lateral carinae and truncated elytral apex, and the following characters are quite common in Glenea members: endophallus with 4 basal plate-like sclerites (Lin et al., 2009; Lin, Tavakilian et al., 2009a,b; Lin & Lin, 2011; Lin & Yang, 2011a, b; Lin et al., 2018), and 3 rod-like sclerites (Lin et al., 2009; Lin, Tavakilian et al., 2009a,b; Lin & Lin, 2011; Lin & Yang, 2011a, b; Lin & Dai, 2012; Lin, 2013); spermathecal capsule strongly sclerotized, composed of an apical orb and a long stalk (Lin et al., 2009; Lin, Tavakilian et al., 2009b; Lin & Yang, 2011a, b; Lin & Dai, 2012). We separate it from Glenea based on the following reasons.: 1) Glenea is heterogeneous (Lin, Montreuil et al., 2009;), even though outer characters are very similar (Lin & Tavakilian, 2012), this peculiar species does not match with any type species of the subgenera; 2) Though most of characters can be found in the previous Glenea members, and the peculiar male sternite might not be suitable for generic level, but with only one band of supporting armature and the emarginated apex of the ventral plate of the median lobe, this convinced the authors to make a new genus. Most members of Saperdini have zero or two bands of supporting armature, rounded to the pointed apex of the ventral plate of the median lobe (Lin et al., 2009; Lin, Tavakilian et al., 2009a, b; Lin & Yang, 2011a, b; Lin & Dai, 2012; Lin, 2013; Lin et al., 2018). 3) Although the sexual dimorphism (on pubescence markings) referred to the subgenus Glenea (Acutoglenea) Breuning, 1958, and the dark integument referred especially to G. (A.) versuta basaloides Breuning 1958, G. (A.) versuta maura Pascoe, 1867, it can not be included in the subgenus Acutoglenea because of the non-simple male claws and very different male terminalia (based on the first author’s unpublished data). Besides, the type species Glenea (Acutoglenea) acuta (Fabricius, 1801) has a stouter female, with elytral length less than twice basal width, fourth antennomere much shorter than scape, which are very different from the new taxon herein described. 4) We have checked the subgenus Glenea (Lineatoglenea) Breuning, 1950, which is represented by a unique type species Glenea (Lineatoglenea) lineatopunctata Breuning, 1950 from Malaysian Borneo. There are no images available, and we did not have an opportunity to examine the type specimen which should be deposited in University of Malaysia, Sarawak (Breuning, 1950a). Based on the original description, it shares with the new taxon by antennae longer than body, similar antennomere ratio, pronotum and elytra, however it differs from the new taxon by the fifth male abdominal segment provided at the end with a short median longitudinal ridge. 5) We have checked the subgenus Glenea (Spiniglenea) Breuning, 1958, which is represented by a unique type species Glenea (Spiniglenea) spinosipennis Breuning, 1958 from Malaysian Borneo. It also has no images available, and we did not have an opportunity to examine the type specimen which should be deposited in University of Malaysia, Sarawak (Breuning, 1958b). Based on the original description, it is difficult to separated it from the new taxon on genus level, since it was based only on a female. However, it is surely not the same species. 6) We compared the new taxon with Glenea (Metaglenea) Breuning, 1956, which is represented by a species from Sumatra, and Glenea (Porphyrioglenea) Breuning, 1956, which is represented by a species from West Malaysia and Sabah, East Malaysia. They can be easily distinguished from the new taxon by the very close antennal tubercles, shorter and stouter antennae. Glenea (Pseudotanylecta) Breuning, 1956, Glenea (Subgrossoglenea) Breuning, 1956, Glenea (Tanylecta) Pascoe, 1866 also from Malaysia and Indonesia, can be separated by the close and protruding antennal tubercles. 7) Glenea (Poeciloglenea) Aurivillius, 1920, Glenea (Punctoglenea) Breuning, 1956, Glenea (Reginoglenea) Breuning, 1956, Glenea (Rubroglenea) Breuning, 1956, Glenea (Rufoglenea) Breuning, 1956, Glenea (Stiroglenea) Aurivillius, 1920, Glenea (Vanikoroglenea) Breuning, 1956, Glenea (Vittiglenea) Breuning, 1956, Glenea (Volumnia) Thomson, 1860 and all other subgenera have been studied by the first author, and none of them are suitable for the new taxon. 8) The new taxon differs from Glenea (Lobunguiglenea) Lin & Tavakilian, 2014 by the male claws with only anterior claw of mesotarsus appendiculate with small lobe in inner side, instead of all claws appenciculated in outer sides, and genitalia with median lobe strongly curved, apex of ventral plate emarginated, instead of genitalia with median lobe slightly curved, apex of ventral plate pointed.Published as part of Lin, Mei-Ying & Ge, Si-Qin, 2021, Tsounkranaglenea hefferni gen. et sp. nov. from Sabah, Malaysia (Coleoptera Cerambycidae, Lamiinae: Saperdini), pp. 289-297 in Zootaxa 5048 (2) on page 290, DOI: 10.11646/zootaxa.5048.2.9, http://zenodo.org/record/555211
Translating China to the Atlantic West: Self, Other, and Lin Yutang's Resistance
This article examines how the Chinese author and translator Lin Yutang challenged the misconstructions of China in the Atlantic West. From the perspective of the inhabitants of the Pacific Rim, the Atlantic is considered a symbol and metaphor for the union of the West (Europe and North America). Due to significant cultural and linguistic differences, China has frequently been misrepresented by Atlantic nations. Within this context, the leading translation theorist Lin Yutang conceived two key translation concepts, tongshun (通顺, fluency) and zhongshi (忠实, fidelity, faithfulness), as powerful weapons to fight against this trend of false recognition. This article analyzes Lin’s means of representing China by looking at (para)textual materials he produced. It explores how Lin combines tongshun and zhongshi to forge a space of zhongyong (中庸, central harmony), a space that reveals the unceasing efforts in mediating, through the translator’s balancing act, between his “Chinese Self” and “Atlantic-Western Other.” The space of zhongyong can be read as Lin’s creation that goes beyond the confines of strict “surrendering” and “withstanding.” Lin’s translation of China to the Atlantic nations therefore presents the possibility of transcending the limits of traditional representations, and offers a renewed understanding of the relationship between China and the Atlantic West
Liphistius liz Lin & Li 2023, sp. nov.
<p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329
Author Co-Citation Analysis (ACA): a powerful tool for representing implicit knowledge of scholar knowledge workers
In the last decade, knowledge has emerged as one of the most important and valuable organizational assets. Gradually this importance caused to emergence of new discipline entitled ―knowledge management‖. However one of the major challenges of knowledge management is conversion implicit or tacit knowledge to explicit knowledge. Thus Making knowledge visible so that it can be better accessed, discussed, valued or generally managed is a long-standing objective in knowledge management. Accordingly in this paper author co- citation analysis (ACA) will be proposed as an efficient technique of knowledge visualization in academia (Scholar knowledge workers)
Correction to: Highly sensitive and robust peroxidase-like activity of Au–Pt core/shell nanorod-antigen conjugates for measles virus diagnosis
After publication of the original article [1], an error was noted in the author affiliation. Lin Long is also affiliated to the College of Opto-electronic Engineering, Zaozhuang University, Zaozhuang, China, which is her first affiliation
Vascular endothelial growth factor restores delayed tumor progression in tumors depleted of macrophages
Genetic depletion of macrophages in Polyoma Middle T oncoprotein (PyMT)-induced mammary tumors in mice delayed the angiogenic switch and the progression to malignancy. To determine whether vascular endothelial growth factor A (VEGF-A) produced by tumor-associated macrophages regulated the onset of the angiogenic switch, a genetic approach was used to restore expression of VEGF-A into tumors at the benign stages. This stimulated formation of a high-density vessel network and in macrophage-depleted mice, was followed by accelerated tumor progression. The expression of VEGF-A led to a massive infiltration into the tumor of leukocytes that were mostly macrophages. This study suggests that macrophage-produced VEGF regulates malignant progression through stimulating tumor angiogenesis, leukocytic infiltration and tumor cell invasion
- …
