600 research outputs found
The Role of Ceramide in Oxidant-mediated Priming of Macrophages for LPS Signaling
No full textIntroduction: Civilian trauma remains a significant health care problem in North American society. Hemorrhagic shock and resuscitation (S/R) have been shown to prime the immune system for an exaggerated response to subsequent otherwise innocuous inflammatory stimuli such as lipopolysaccharide (LPS), resulting in multiple organ failure or death. Using a rodent model of lung injury, we previously demonstrated that antecedent S/R leads to augmented LPS-induced lung injury by way of heightened NF-κB nuclear translocation, resulting in increased elaboration of pro-inflammatory cytokines in alveolar macrophages. Further studies revealed that oxidative stress generated during S/R is responsible for this priming phenomenon. Our group recently identified two significant alterations to LPS signaling under oxidative stress conditions in macrophages: 1) the rapid recruitment of the LPS receptor Toll-like receptor 4 (TLR4) to membrane lipid rafts, and 2) the reprogramming of LPS signaling to a Src-dependent pathway involving phosphatidylinositol 3-kinase (PI3K).
Major Objective and Hypothesis: The objective of this thesis is to elucidate the molecular mechanisms underlying the augmented cellular responsiveness observed in macrophages following oxidative stress. The central hypothesis is that oxidative stress regulates LPS signaling by altering the activation and assembly of TLR4 receptor signaling components through generation of the lipid ceramide.
Summary of Findings: In the first paper, we demonstrate that the antioxidant stilbazulenyl nitrone (STAZN), a novel second-generation azulenyl nitrone, is protective in a rodent two-hit model of lung injury involving hemorrhagic S/R and subsequent intra-tracheal LPS injection. Resultant oxidative stress and lung injury in vivo were significantly reduced by STAZN following S/R and LPS. In the second paper, we explore the mechanism underlying oxidant-induced surface up-regulation of TLR4 in macrophages. Using immunofluorescence microscopy and flow cytometry techniques, hydrogen peroxide in vitro and hemorrhagic S/R in vivo are shown to induce TLR4 translocation in macrophages in a ceramide and Src-dependent manner, and the enzyme acid sphingomyelinase (ASM) is shown to mediate ceramide generation. In the third paper, the role of ceramide in oxidant-induced macrophage priming for LPS signaling is investigated. Ceramide generation via ASM is shown to have a prominent upstream role in oxidant activation of the PI3K/Akt pathway via Src kinases in macrophages. Furthermore, oxidative stress is shown to reprogram LPS signaling to a ceramide dependent pathway.
Conclusion: Together, these findings highlight the role of oxidative stress in mediating augmented cellular responsiveness following S/R, and describe the role of ceramide as a central upstream mediator of oxidant priming in macrophages. The hierarchy of signaling molecules and interactions described herein represent novel targets for modulating oxidative stress in the treatment of critical illness and organ injury.Ph
The Role of Ceramide in Oxidant-mediated Priming of Macrophages for LPS Signaling
No full textIntroduction: Civilian trauma remains a significant health care problem in North American society. Hemorrhagic shock and resuscitation (S/R) have been shown to prime the immune system for an exaggerated response to subsequent otherwise innocuous inflammatory stimuli such as lipopolysaccharide (LPS), resulting in multiple organ failure or death. Using a rodent model of lung injury, we previously demonstrated that antecedent S/R leads to augmented LPS-induced lung injury by way of heightened NF-κB nuclear translocation, resulting in increased elaboration of pro-inflammatory cytokines in alveolar macrophages. Further studies revealed that oxidative stress generated during S/R is responsible for this priming phenomenon. Our group recently identified two significant alterations to LPS signaling under oxidative stress conditions in macrophages: 1) the rapid recruitment of the LPS receptor Toll-like receptor 4 (TLR4) to membrane lipid rafts, and 2) the reprogramming of LPS signaling to a Src-dependent pathway involving phosphatidylinositol 3-kinase (PI3K).
Major Objective and Hypothesis: The objective of this thesis is to elucidate the molecular mechanisms underlying the augmented cellular responsiveness observed in macrophages following oxidative stress. The central hypothesis is that oxidative stress regulates LPS signaling by altering the activation and assembly of TLR4 receptor signaling components through generation of the lipid ceramide.
Summary of Findings: In the first paper, we demonstrate that the antioxidant stilbazulenyl nitrone (STAZN), a novel second-generation azulenyl nitrone, is protective in a rodent two-hit model of lung injury involving hemorrhagic S/R and subsequent intra-tracheal LPS injection. Resultant oxidative stress and lung injury in vivo were significantly reduced by STAZN following S/R and LPS. In the second paper, we explore the mechanism underlying oxidant-induced surface up-regulation of TLR4 in macrophages. Using immunofluorescence microscopy and flow cytometry techniques, hydrogen peroxide in vitro and hemorrhagic S/R in vivo are shown to induce TLR4 translocation in macrophages in a ceramide and Src-dependent manner, and the enzyme acid sphingomyelinase (ASM) is shown to mediate ceramide generation. In the third paper, the role of ceramide in oxidant-induced macrophage priming for LPS signaling is investigated. Ceramide generation via ASM is shown to have a prominent upstream role in oxidant activation of the PI3K/Akt pathway via Src kinases in macrophages. Furthermore, oxidative stress is shown to reprogram LPS signaling to a ceramide dependent pathway.
Conclusion: Together, these findings highlight the role of oxidative stress in mediating augmented cellular responsiveness following S/R, and describe the role of ceramide as a central upstream mediator of oxidant priming in macrophages. The hierarchy of signaling molecules and interactions described herein represent novel targets for modulating oxidative stress in the treatment of critical illness and organ injury.Ph
Cellular Mechanisms of the Systemic Inflammatory Response Following Resuscitated Hemorrhagic Shock: The Role of Reactive Oxygen Species and Toll-like Receptor 4
No full textAcute Respiratory Distress Syndrome (ARDS) following hemorrhagic
shock/resuscitation (S/R) is an important contributor to late morbidity and mortality in trauma
patients. S/R promotes ARDS by inducing oxidative stress that primes cells of the innate
immune system for excessive responsiveness to small inflammatory stimuli, termed the “twohit”
hypothesis. Activated alveolar macrophages (AM) play a central role and when recovered
from S/R animals exhibit an exaggerated responsiveness to lipopolysaccharide (LPS) with
increased activation of the proinflammatory transcription factor NF-κB, and augmented
expression of cytokines. LPS triggers AM signalling through Toll like receptor 4 (TLR4), which
resides in plasma membrane lipid rafts.
The objective of this work is to define cellular mechanisms of macrophage priming by
oxidative stress following shock resuscitation. The main hypothesis investigated is that altered
cellular distribution of TLR4 can lead to macrophage priming and antioxidant resuscitation
strategies can diminish these effects.
AM of rodents, exposed in vivo to oxidant stress following S/R, increase their surface
levels of TLR4, which in turn results in augmented NF-κB translocation in response to small
doses of LPS. Furthermore, in vitro H2O2 treatment of RAW 264.7 macrophages results in
similar TLR4 surface translocation. Depletion of intracellular calcium, disruption of the
cytoskeleton or inhibition of the Src kinases prevents the H2O2-induced TLR4 translocation,
suggesting the involvement of receptor exocytosis. Further, fluorescent resonance energy
iii
transfer between TLR4 and lipid rafts as well as biochemical raft analysis demonstrated that
oxidative stress redistributes TLR4 to surface lipid rafts. Preventing the oxidant-induced
movement of TLR4 to lipid rafts using methyl-ß-cyclodextrin precluded the increased
responsiveness of cells to LPS after H2O2 treatment. Further, AM priming by oxidative stress
can be diminished by early exposure to resuscitation regimens with direct or indirect systemic
antioxidant effects, such as 25% albumin, N-acetylcysteine and hypertonic saline.
Hyperosmolarity was found to modulate AM TLR4 gene and protein expression.
Collectively, these studies suggest a novel mechanism whereby oxidative stress might
prime the responsiveness of cells of the innate immune system. Targeting the TLR4 signalling
pathway early during shock resuscitation may represent an anti-inflammatory strategy able to
ameliorate late morbidity and mortality following S/R.Ph
Cellular Mechanisms of the Systemic Inflammatory Response Following Resuscitated Hemorrhagic Shock: The Role of Reactive Oxygen Species and Toll-like Receptor 4
No full textAcute Respiratory Distress Syndrome (ARDS) following hemorrhagic
shock/resuscitation (S/R) is an important contributor to late morbidity and mortality in trauma
patients. S/R promotes ARDS by inducing oxidative stress that primes cells of the innate
immune system for excessive responsiveness to small inflammatory stimuli, termed the “twohit”
hypothesis. Activated alveolar macrophages (AM) play a central role and when recovered
from S/R animals exhibit an exaggerated responsiveness to lipopolysaccharide (LPS) with
increased activation of the proinflammatory transcription factor NF-κB, and augmented
expression of cytokines. LPS triggers AM signalling through Toll like receptor 4 (TLR4), which
resides in plasma membrane lipid rafts.
The objective of this work is to define cellular mechanisms of macrophage priming by
oxidative stress following shock resuscitation. The main hypothesis investigated is that altered
cellular distribution of TLR4 can lead to macrophage priming and antioxidant resuscitation
strategies can diminish these effects.
AM of rodents, exposed in vivo to oxidant stress following S/R, increase their surface
levels of TLR4, which in turn results in augmented NF-κB translocation in response to small
doses of LPS. Furthermore, in vitro H2O2 treatment of RAW 264.7 macrophages results in
similar TLR4 surface translocation. Depletion of intracellular calcium, disruption of the
cytoskeleton or inhibition of the Src kinases prevents the H2O2-induced TLR4 translocation,
suggesting the involvement of receptor exocytosis. Further, fluorescent resonance energy
iii
transfer between TLR4 and lipid rafts as well as biochemical raft analysis demonstrated that
oxidative stress redistributes TLR4 to surface lipid rafts. Preventing the oxidant-induced
movement of TLR4 to lipid rafts using methyl-ß-cyclodextrin precluded the increased
responsiveness of cells to LPS after H2O2 treatment. Further, AM priming by oxidative stress
can be diminished by early exposure to resuscitation regimens with direct or indirect systemic
antioxidant effects, such as 25% albumin, N-acetylcysteine and hypertonic saline.
Hyperosmolarity was found to modulate AM TLR4 gene and protein expression.
Collectively, these studies suggest a novel mechanism whereby oxidative stress might
prime the responsiveness of cells of the innate immune system. Targeting the TLR4 signalling
pathway early during shock resuscitation may represent an anti-inflammatory strategy able to
ameliorate late morbidity and mortality following S/R.Ph
Jealous Men but Evil Women: The Double Standard in Cases of Domestic Homicide
No full textIn 1989, Sarah Thornton killed her abusive husband with a knife, after years of abuse and threats to her daughter. She was convicted of murder and sentenced to life imprisonment. Also in 1989, Kiranjit Ahluwalia soaked her husband’s bedclothes with petrol and set them alight. He died from burns 10 days later, and she was subsequently convicted of murder and sentenced to life in prison.
In 1991, Joseph McGrail kicked his alcoholic common-law wife to death whilst she lay unconscious. He walked free from court, the judge telling him that “this lady would have tried the patience of a saint”. In 1992, Les Humes told a court that he “saw a red mist” after his wife admitted loving someone else. He fatally stabbed her whilst their teenage children struggled with him. He was convicted of manslaughter due to provocation and was imprisoned for 7 years.
Double standards in judicial processes are notorious. Chivalric justice is the case in which women are given lighter sentences for similar offences to men. This does not apply in the case of domestic homicide, where women are seen as evil and calculating when killing a spouse, men are seen as provoked beyond reason. Women who kill husbands do so with weapons that they need to acquire, men do it with their hands or weapons that are immediately available. So it is seems the defence of crime passionnel is reserved for men; women, it is implied, premeditate the murder of abusive husbands, and are justifiably punished. This paper explores the double standard in uxoricide vs. mariticide, and why it appears that killing a wife is justified and killing a husband is evi
Morbidity and Mortality Weekly Report (MMWR)
No full textMMWR visual abstract for: Hassan R, Buuck S, Noveroske D, Medus C, Sorenson A, Laurent J, Rotstein D, Schlater L, Freiman J, Douris A, Simmons M, Donovan D, Henderson J, Tewell M, Snyder K, Oni O, Von Stein D, Dassie K, Leeper M, Adediran A, Dowell N, Gieraltowski L, Basler C. Multistate Outbreak of Salmonella Infections Linked to Raw Turkey Products - United States, 2017-2019. MMWR Morb Mortal Wkly Rep. 2019 Nov 22;68(46):1045-1049.11.22.2019_Turkey_1200x675_new.jp
Effect of Remote Ischemic Conditioning in Hemorrhagic Shock/Resuscitation
No full textTraumatic injuries remain a leading cause of death worldwide despite advances in resuscitation care, causing substantial burden to society. Trauma complicated with hemorrhagic shock/resuscitation (S/R) represents a form of global ischemia/reperfusion injury that promotes oxidative stress, systemic inflammation, and coagulopathy, which together contribute to organ dysfunction and poor outcomes. Therefore, strategies directed at preventing onset of ischemia/reperfusion injury have substantial potential to improve outcomes. Remote ischemic conditioning (RIC) is a simple non-invasive intervention in which a limb is subjected to sequential cycles of brief ischemia/reperfusion by inflation and deflation of a pressure cuff. RIC protects organs against ischemia/reperfusion injury in both experimental and clinical settings, but its effects in S/R has not been well defined. In this thesis, we investigated the efficacy of RIC in both pre-clinical and clinical settings. We first demonstrated in a murine model of S/R that RIC prevented organ injury and inflammation when administered before shock, during shock, and at resuscitation, suggesting its potential utility in trauma. This protective effect was mediated by induction of antioxidant response through the transcription factor Nrf2. Furthermore, humoral factors liberated by RIC prevented neutrophil migration in response to injury and oxidant-induced mortality. A unique finding was that transfusion with RIC donor blood protected the recipient animal from S/R induced organ injury and inflammation, suggesting a novel paradigm to administer RIC. To translate our findings to the clinical setting, we conducted a Phase II randomized controlled trial to investigate the feasibility and effects on the immune-inflammatory and coagulation profiles of RIC administered to trauma patients sustaining hemorrhagic shock. A total of 50 patients were enrolled, in whom in-hospital RIC was successfully and safely administered to most of the patients. Although RIC did not significantly influence clinical outcomes, RIC prevented neutrophil degranulation, modulated release of Th2 chemokines, and exerted a favourable coagulation profile in the early resuscitation period. Taken together, our work establishes RIC as a potential therapeutic intervention that can be safely administered to patients in the acute injury setting. Future studies aimed at characterizing the mechanisms of RIC and optimizing its administration may lead to beneficial outcomes in trauma patients.Ph.D
Effect of Remote Ischemic Conditioning in Hemorrhagic Shock/Resuscitation
No full textTraumatic injuries remain a leading cause of death worldwide despite advances in resuscitation care, causing substantial burden to society. Trauma complicated with hemorrhagic shock/resuscitation (S/R) represents a form of global ischemia/reperfusion injury that promotes oxidative stress, systemic inflammation, and coagulopathy, which together contribute to organ dysfunction and poor outcomes. Therefore, strategies directed at preventing onset of ischemia/reperfusion injury have substantial potential to improve outcomes. Remote ischemic conditioning (RIC) is a simple non-invasive intervention in which a limb is subjected to sequential cycles of brief ischemia/reperfusion by inflation and deflation of a pressure cuff. RIC protects organs against ischemia/reperfusion injury in both experimental and clinical settings, but its effects in S/R has not been well defined. In this thesis, we investigated the efficacy of RIC in both pre-clinical and clinical settings. We first demonstrated in a murine model of S/R that RIC prevented organ injury and inflammation when administered before shock, during shock, and at resuscitation, suggesting its potential utility in trauma. This protective effect was mediated by induction of antioxidant response through the transcription factor Nrf2. Furthermore, humoral factors liberated by RIC prevented neutrophil migration in response to injury and oxidant-induced mortality. A unique finding was that transfusion with RIC donor blood protected the recipient animal from S/R induced organ injury and inflammation, suggesting a novel paradigm to administer RIC. To translate our findings to the clinical setting, we conducted a Phase II randomized controlled trial to investigate the feasibility and effects on the immune-inflammatory and coagulation profiles of RIC administered to trauma patients sustaining hemorrhagic shock. A total of 50 patients were enrolled, in whom in-hospital RIC was successfully and safely administered to most of the patients. Although RIC did not significantly influence clinical outcomes, RIC prevented neutrophil degranulation, modulated release of Th2 chemokines, and exerted a favourable coagulation profile in the early resuscitation period. Taken together, our work establishes RIC as a potential therapeutic intervention that can be safely administered to patients in the acute injury setting. Future studies aimed at characterizing the mechanisms of RIC and optimizing its administration may lead to beneficial outcomes in trauma patients.Ph.D
Supplementary Table S1: Improved SARS-COV-2 PCR detection and genotyping with double-bubble primers
No full text
Table S1 Primers
assignment. GAPDH- Glyceraldehyde 3-Phosphate Dehydrogenase. “N”- SARS-COV2
nucleocapsid gene. “S”- Spike gene. Normal Type primer - conventional primer
usually 20bp. D-B Type primer- Double-Bubble primer with stem-loop and
homo-dimer configurations. TqMTaqMan. Sense- 5’-->3’ primer orientation,
AS- anti- sense 3’à5’ primer orientation. Ntnucleotide numbers in primer.
Amplicon- size of PCR product in base pairs (bp). Region 1: primers # 3-8 in
SARS-COV-2 gene “N”. Region 2: primers #9 and #10 in SARS-COV-2 gene “N”.
Region 3: primer #11 in SARS-COV-2 gene “S”. We also designed 2 TaqMan (TqM)
probes with non-fluorescent quencher (NFQ) and 2 different reporter dyes for
each region (see also Fig. S3; probes #12 and #13, 45nt and 44nt, VIC and FAM
dyes, regions 1 and 2, No Gene Type Orient Nt Sequence Amplicon (bp) Region 1
GAPDH Normal Sense 20 GGAAGGTGAAGGTCGGAGTC 135 1’ GAPDH Normal AS 25
ACATGTAAACCATGTAGTTGAGGTC 135 2 GAPDH D-B Sense 30 cacctatggg
GGAAGGTGAAGGTCGGAGTC 152 2’ GAPDH D-B AS 32 atggttaACATGTAAACCATGTAGTTGAGGTC
152 3 “N” Normal Sense 21 GCAGAGACAGAAGAAACAGCA 96 1 3’ “N” Normal AS 20
TCAGCACTGCTCATGGATTG 96 1 4 “N” D-B Sense 30 ctgtct gacGCAGAGACAGAAGAAACAGCA
115 1 4’ “N” D-B AS 30 gcagtgactgTCAGCACTGCTCATGGATTG 115 1 5 “N” Normal
Sense 20 CAAGCCTTACCGCAGAGACA 119 1 5’ “N” Normal AS 20 GCCTGAGTTGAGTCAGCACT
119 1 6 “N” Normal Sense 30 TGATGAAACTCAAGCCTTACCGCAGAGACA 139 1 6’ “N”
Normal AS 30 ATGAGTTTAGGCCTGAGTTGAGTCAGCACT 139 1 7 “N” Normal Sense 30
ataaccaccaCAAGCCTTACCGCAGAGACA 139 1 7’ “N” Normal AS 30
atatttgactGCCTGAGTTGAGTCAGCACT 139 1 8 “N” D-B Sense 30
taaggccaaaCAAGCCTTACCGCAGAGACA 139 1 8’ “N” D-B AS 30
aactcagctcGCCTGAGTTGAGTCAGCACT 139 1 9 “N” Normal Sense 20
TCTTGCTTTGCTGCTGCTTG 138 2 9’ “N” Normal AS 20 GCAGTACGTTTTTGCCGAGG 138 2 10
“N” D-B Sense 30 aagcaatgggTCTTGCTTTGCTGCTGCTTG 158 2 10’ “N” D-B AS 30
cgtacgacgaGCAGTACGTTTTTGCCGAGG 158 2 11a “S” D-B Sense 31
aaaccacggcgATATGGTTTCCAACCtACTa 111 3 11b “S” D-B Sense 30
aaaccacgcgATATGGTTTCCAACCtACTt 111 3 11c “S” D-B AS 30 gtggacgacgTAGGTCCACAAACAGTTGCT
111 3 12 “N” TqM Sense 45 VIC-ACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTG
-NFQ-MGB 1 13 “N” TqM Sense 44
FAM-CAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAA -NFQ-MGB 2 respectively).
The TqM probes were longer than the normal TqM probes to afford binding at
higher annealing temperatures to take advantage of the longer D-B primers,
for improved specificity and shorter PCR cycling. However, the TqM probe
could not exceed the 45nt length since at longer molecular distance, the NFQ
quenching capabilities of the reporter dye are not effective. In addition,
the TqM probes included a minor groove binder (MGB) moiety at the 3’- end
that increases the melting temperature (Tm) of the probe and stabilizes
probe/target hybrids (ThermoFisher Scientific). Regions in D-B primers:
Uppercase letters- sequence-specific. Uppercase black letters- 3’-overhang.
Uppercase red bold letters and lowercase red letters- stem region. Uppercase
red letters and lowercase green letters- loop region. Lowercase blue background
letters in 3’-end of primer 13a: wild type “a”, and primer 13b- mutant “t”.
Lowercase blue letter “t” in position minus 5 in primers 11a and 11b
represents mismatch càt mutation introduced to weaken the primer annealing to
its target. Locations of primers in the SARS-COV-2 genome are shown in Figure
S3. Primer analysis was performed using IDT’s Oligo Analyzer Version 3.1.
Care was taken to avoid primer-hetero-dimers.
</div
A complete O(alpha_S^2) calculation of the signal-background interference for the Higgs diphoton decay channel
No full textWe present the full O(αS2) computation of the interference effects between the Higgs diphoton signal and the continuum background at the LHC. While the main contribution to the interference originates on the gg partonic subprocess, we find that the corrections from the qg and qq̄ channels amount up to 35 % of it. We discuss the effect of these new subprocesses in the shift of the diphoton invariant mass peak recently reported by S. Martin in (Phys. Rev. D 86:073016, 2012).Fil: de Florian, Daniel Enrique. Consejo Nacional de Investigaciones Científicas y Técnicas. Oficina de Coordinación Administrativa Ciudad Universitaria. Instituto de Física de Buenos Aires. Universidad de Buenos Aires. Facultad de Ciencias Exactas y Naturales. Instituto de Física de Buenos Aires; ArgentinaFil: Fidanza Romani, Nerina Andrea. Universidad de Buenos Aires. Facultad de Cs.exactas y Naturales. Departamento de Fisica; . Consejo Nacional de Investigaciones Científicas y Técnicas. Oficina de Coordinación Administrativa Ciudad Universitaria; ArgentinaFil: Hernandez Pinto, Roger Jose. Universidad de Buenos Aires. Facultad de Cs.exactas y Naturales. Departamento de Fisica;Fil: Mazzitelli, Javier Sebastián. Universidad de Buenos Aires. Facultad de Cs.exactas y Naturales. Departamento de Fisica; . Consejo Nacional de Investigaciones Científicas y Técnicas. Oficina de Coordinación Administrativa Ciudad Universitaria; ArgentinaFil: Rotstein Habarnau, Yamila Valeria. Universidad de Buenos Aires. Facultad de Cs.exactas y Naturales. Departamento de Fisica; . Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Sborlini, Germán Fabricio Roberto. Universidad de Buenos Aires. Facultad de Cs.exactas y Naturales. Departamento de Fisica; . Consejo Nacional de Investigaciones Científicas y Técnicas. Oficina de Coordinación Administrativa Ciudad Universitaria; Argentin
- …
