106,481 research outputs found
Letter, [Author unclear] to Paulina T. Merritt
Handwritten letter to Paulina Merritt from an unknown author, October 1, 1876.
THE 118 MEDICAL EMERGENCY CARE DURING COVID-19: NEW STRATEGIES FOR FUTURE PANDEMICS
In Italy, acute life-threatening situations are handled by the 118 Emergency Service and pre-hospital medical facilities that rely upon centralized call reception, medical dispatching, and on-site emergency medical care before hospitalization care. The 118 services ensure that medical and paramedical units are often the first on the spot. At the same time, the professional skills of the dispatching physician are essential to ascertain the patient's needs to preserve life and vital functions while ensuring the appropriate emergency healthcare in the nearby hospital facilities.
The main reasons for suboptimal emergency care in life-threatening situations like the ones presented by the COVID-19 pandemic were a notch issue, with medical facilities being extremely reduced in some country areas, fewer volunteers and physicians, hospital reorganization, very tight funding, and the low skills of "first-on -the-scene" emergency workers. This raised the question of equal healthcare opportunity for everyone and the need for more qualified medical education, especially regarding emergency healthcare professionals, such as assistants, paramedicals, and drivers. COVID-19 urged an improvement in the system's efficiency with a plan for achieving objectives together with implementing a network of emergency services with varying degrees of emergency healthcare management. [...
Dual-band reflectarray antenna: Design and experimental validation
In this paper, we present the design and the analysis of a prototype dual band dual-layer planar reflectarray antenna with two feeds. The resulting antenna is lightweight, foldable on the roof of a vehicle and easily deployable when in operation
Sui an Xu shi cong shu : [10 zhong] /
Ten works, each with special t. p.General table of contents has caption title: Sui an Xu shi cong shu.Ten works, each with special t.p.Mode of access: Internet
CO2 laser with transverse RF excitation
Translated from German (Paper at 7. Int. Cong. on Laser/Optoelectronics in Engineering 1986 Berlin (DE) p. 40-45)Available from British Library Document Supply Centre- DSC:9312.57(WI-Trans--757)T / BLDSC - British Library Document Supply CentreSIGLEGBUnited Kingdo
Handwritten biographical information on Paulina T. McClung Merritt
A handwritten biography of Paulina T. McClung Merritt by an unknown author, 1892.
Telegonus subflavus Zhang, Cong, Shen & Grishin, 2022, new species
Telegonus subflavus Grishin, new species http://zoobank.org/ 460487EA-BD24-468A-A335-4F0B49C5DC7A As shown above, Telegonus galesus form subflavus Williams, 1927 (type locality Ecuador: Riobamba) is an infrasubspecific name with the “ holotype ” that is a species distinct from Telegonus galesus Mabille, 1888 (type locality Peru: Chanchamayo). This species does not have a valid name, and therefore is new. Here, we apply the same epithet subflavus (a masculine adjective) to this species, which according to ICZN Article 45.5.1. would establish it as new, provided that the description of this species, including its holotype designation and illustration are given in Williams (1927b: 281, pl. 24, fig. 4), all are adopted here. It is distinguished from T. galesus by more extensive yellow overscaling on wings below, especially in the discal area of ventral hindwing. The holotype (NVG-15096B05) (Fig. 2h,i), male, in the collection of the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH) is already conveniently labeled as “ Telegonus subflavus ”, the exact name that is applied to it now. It bears the following six labels: || Riobamba | Ecuador || Type | Telegonus | subflavus | R.C. Williams,Jr. | 7128 || CMNH HOLOTYPE #762 | Telegonus | subflavus | Williams || Insect collection | CARNEGIE MUSEUM OF | NATURAL HISTORY | Pittsburg, Pa. (CMNH) || Allyn Museum photo | No. 820630-3/4 || DNA sample ID: | NVG-15096B05 | c/o Nick V. Grishin ||. The COI barcode sequence of the holotype is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAG G A AC C C C C G G ATC T T TA AT TG G TG ATG ATC A A AT T TATA ATAC TAT TG TA AC AG C C C ATG C AT T TAT TATA ATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTAATAATAGGAGCTCCA G A TA TA G C T T T C C C T C G TA TA A A TA A TA TA A G A T T T T G A C T T T TA C C C C C A T C A T TA A C T T TA T TA ATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCAT CAAGGAACATCCGTTGACTTAGCAATTTTTTCATTACATCTTGCTGGTATTTCATCTATTCTTGGAGCTATTAATTT TATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAAT TACAGCATTACTATTATTACTTTCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTA AATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATCTATTT It differs from T. galesus by the following combination of characters (among a number of others): 19T, 38G, 85C, 100T, 112T, 133C, 187C, 197T, 205C, 206C, 220T, 223A, 138T, 334A, 374A, 379C, 397T. The type locality is Ecuador: Riobamba. The species is also know from Colombia and Peru with 3 paratypes, NVG-18056D07 ♂, NVG-18056D09 ♀, both from Colombia: Pacho, in ZfBS, and NVG-18028H03 ♂ from Peru: Cusco, in the USNM (Fig. 1). Type identification labels will be mailed to curators of these collections to be placed on the specimens of the type series. Apparently, the range of this new species overlaps with T. galesus and they may be sympatric in Peru.Published as part of Zhang, Jing, Cong, Qian, Shen, Jinhui & Grishin, Nick V., 2022, Taxonomic changes suggested by the genomic analysis of Hesperiidae (Lepidoptera), pp. 1-135 in Insecta Mundi 2022 (921) on page 22, DOI: 10.5281/zenodo.639205
Heterogeneous and tissue-specific regulation of effector T cell responses by IFN-gamma during Plasmodium berghei ANKA infection.
IFN-γ and T cells are both required for the development of experimental cerebral malaria during Plasmodium berghei ANKA infection. Surprisingly, however, the role of IFN-γ in shaping the effector CD4(+) and CD8(+) T cell response during this infection has not been examined in detail. To address this, we have compared the effector T cell responses in wild-type and IFN-γ(-/-) mice during P. berghei ANKA infection. The expansion of splenic CD4(+) and CD8(+) T cells during P. berghei ANKA infection was unaffected by the absence of IFN-γ, but the contraction phase of the T cell response was significantly attenuated. Splenic T cell activation and effector function were essentially normal in IFN-γ(-/-) mice; however, the migration to, and accumulation of, effector CD4(+) and CD8(+) T cells in the lung, liver, and brain was altered in IFN-γ(-/-) mice. Interestingly, activation and accumulation of T cells in various nonlymphoid organs was differently affected by lack of IFN-γ, suggesting that IFN-γ influences T cell effector function to varying levels in different anatomical locations. Importantly, control of splenic T cell numbers during P. berghei ANKA infection depended on active IFN-γ-dependent environmental signals--leading to T cell apoptosis--rather than upon intrinsic alterations in T cell programming. To our knowledge, this is the first study to fully investigate the role of IFN-γ in modulating T cell function during P. berghei ANKA infection and reveals that IFN-γ is required for efficient contraction of the pool of activated T cells
Dispelling the Myths Behind First-author Citation Counts
We conducted a full-scale evaluative citation analysis study of scholars in the XML research field to explore just how different from each other author rankings resulting from different citation counting methods actually are, and to demonstrate the capability of emerging data and tools on the Web in supporting more realistic citation counting methods. Our results contest some common arguments for the continued
use of first-author citation counts in the evaluation of scholars, such as high correlations between author rankings by first-author citation counts and other citation
counting methods, and high costs of using more realistic citation counting methods that are not well-supported by the ISI databases. It is argued that increasingly available digital full text research papers make it possible for citation analysis studies to go beyond what the ISI databases have directly supported and to employ more
sophisticated methods
Pelevin’s Trinity in the novel “t”: author – protagonist – reader
The article attempts to interpret Pelevin's artistic strategy in the novel "T" by exploring its subject organization and addressing the key problems of the author, the protagonist, and the reader as they are seen by the researcher. The article analyzes the peculiarities of constructing the narrative reality in the novel "T", and goes on to discuss Pelevin's philosophic models of the development of the humankind, and the emergence of his new anthropology
- …
