UGM Journals, OAI Repository
Not a member yet
    12430 research outputs found

    ANALISIS SWOT DALAM PERUMUSAN S TRATEGI PENINGKATAN KEPUASAN PASIEN RAWAT JALAN INSTALASI FARMASI RUMAH SAKIT X SAMARINDA

    Get PDF
    Increase in intensity has forced Pharmacy Department of X Hospital Samarinda to continously concern on patient needs and pretension as well as always tried to fulfill what patients expectation. In order to formulating the strategy to face the competition, pharmacy department of hospital needs to identify internal and external bariers. Research was aimed to know level of outpatient satisfaction in pharmacy department of X Hospital Samarinda and formulating strategy to improve outpatient satisfaction. Research design was descriptive. Instruments developed by quantitative and qualitative approach. Quntitative data obtained using questionnaires that given to outpatients in order to explore customer satisfaction. Qualitative data was obtained by indepth interview with pharmacy department chief, hospital director, employees, doctors, and supplier. Data were analised with Servqual and Strength, Weakness, Opportunity and Threat (SWOT) method. Research result showed that there were negative gap on five ssrvice dimensions. Negative gap showed that patient\u27s expectation were higher than services that has given by pharmacy department of hospital so patient satisfactions were not yet been achieved. Gap point dimension of services from the highest to the lowest were tangibles (-0,29), responsiveness (-0,22), reliability (-0,13), assurance (-0,11), and empathy (-0,08). Result of SWOT analysis based on analysis of internal and external sphere of pharmacy department of X Hospital Samarinda showed that pharmacy department of hospital had bigger opportunity but in same way face the weaknesses. Alternative strategies in order to improve patient satisfaction were develop structures and infrastructures, determine limitation of dispensing time, provision of drug information and counseling, and effort to increase drugs availability

    CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon)

    Get PDF
    Resveratrol is a potent anti cancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encodinggene from melinjo plant (Gnetumgnemon L.) has been carried out as pan of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5\u27 GTTCCACCTGCGAAGCAGCC37 and GGR2 (5\u27 CTGGATCGCACATCC TGGTG 37 primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gen

    PARADIGMA KOMUNIKATIF: SEBUAH TAWARAN MODEL DALAM PEMBANGUNAN HUKUM

    Get PDF
    The rise of legal positivism paradigm places state law as the truest law. Nevertheless, there are other legal systems, such as religious and customary laws that have different cultural and political systems. Therefore, development in the field of law shall attempt to connect to the various existing legal systems. Menguatnya paradigma positivisme hukum menempatkan hukum negara sebagai hukum yang paling benar. Namun kenyataannya ada sistem hukum lain, seperti hukum adat dan agama, yang memiliki perbedaan sistem budaya, politik, serta kepercayaan. Karenanya, pembangunan di bidang hukum seharusnya merupakan upaya untuk mengkomunikasikan berbagai sistem hukum yang ada tersebut

    The Effect 0f Reciting Holy Qur\u27 an toward Short-term Memory Ability Analysed tronght the Changing Brain Wave

    Get PDF
    Thepresentstudy examinedtheeffectof recitingHoly Qur\u27an towardshort-termmemory ability appearance from the change of the brain wave. Subjects of this study werefour female students (n=4) from Gadjah Mada University with homogeneity of genders, age, the frequencies of reciting Holy Qur\u27an, menstruation\u27s phase, timbre and ethnic groups. Subjects were divided randomly into two groups, i.e. experiment and control group. Each group was recorded with electroencephalograph (EEG) on their brain wave. The process of recording used monopolar method with placement of electrode10-20 and the researchergive afree recall test. Either recording orfree recall test is carriedout twice, beforeand after execution and placebo. T-test result in experiment group from free recall test found significant are differences (t=- 15,00p&#88040.05) between before and after reciting the Holy Qur\u27an. T-test result in control group found that significantly not differences (t=-ll,OOp&#8805O,05) between before and after placeboeffect. Hypotheses accepted i.e. there is significantly increasing in experiment group, beforeand after the execution. After the execution brain wave increased significantly in point Fp1, point Fp2 and point P4. In point Fp1, &#946, &#945, and &#955significantly increased. In point Fp2, all of the wave significantly increased. In point P4, the wave increased were &#946, &#955and &#963, It means that when reciting Holy Qur\u27 an, showed there is increased activity like thinking, emotionally and religion-related-activity or God

    Keterlibatan, Keberhargaan, dan Kompetensi Sosial sebagai Prediktor Kompetisi pada Remaja

    Get PDF
    Competition is a common phenomenon among adolescents, that shows the drives to express the ability, to compare self with others, and to strive to be the best. This study was aimed to assess whether the engagement, sense of worth, and social competence can be the predictors of the emergence of competition in adolescents. Subjects were amounted to 232 students, including the students from favorite and non-favorite junior and high school in the city of Yogyakarta and Gunungkidul. The instrument used were the engagement\u27 scale, sense of worth\u27 scale, social competence\u27 scale, and competition\u27 scale. The data then were analized using regression approachand also t-test for additional analysis. The results showed that there was the influence of engagement, sense of worth, and social competence to the competition (F=65.274,

    Pengaruh Terapi Menulis Pengalaman Emosional Terhadap Penurunan Depresi pada Mahasiswa Tahun Pertama

    Get PDF
    In the first year, college students will get the stressful events which related to leave parents andfriends, also the transition of educational system and new home stay. The stressful events can cause negative of cognitive and emotional responses to college students. Therefore, it can cause depression on college student self. This research aims to test the effect writing about emotional experiences therapy on reducing depressionfor thefirst year collegestudents. Researchdesign uses two matched groups design. Subjects (N=12) were divided into experimentalgroup (n=6)or controlgroup (n=6).Theexperimentalgroup was instructed to write about emotional experiences in four writing sessions lasting :t 30 minutes. Outcomes were measured at pretest, posttest, andfollow up by Mixed ANOV A Design. Between Group ANOV A indicated the groups differed significantly on depression (F=25.88,p=.OO1).Within Group ANOV A indicated that experimental group reported significantly reduced depression at pretest, posttest, and follow up (F=33.72, p=.OO1).Post hoc test revealed thai the repeat experimental group reported significantly reduced depression at pretest-posttest (p=.003), posttest1011owup (p>0,33), and pretest-follow up (

    Metode Relaksasi Untuk Menurunkan Stres dan Keluhan Tukak Lambung pada Penderita Tukak Lambung Kronis

    Get PDF
    Individual disability to manage stress results the body become susceptible to diseases so that some physical disorders like gastritis enable to see. Gastritis represent one of psychosomatic disorders, a physiological disorder caused by a major psychologicalfactor, stress as a common. This research is aimed to test the relaxation method that is used to lessen stress and the sigh of gastritis pain for the patients of chronic gastritis. The researchapplies the single case experimental design. Subjects of the research are three women who get treatment of Imagery Relaxation Therapy and Muscle Relaxation Therapyfor three times. Then, they are monitored by self monitoring for 3 weeks. The instruments used in this experiment are Scale of Stress compiled by Prawitasari (1989), and Sigh of Gastritis Pain Scale adapted from Sigh. of Physical Gastritis Scale compiled by Sutrisno (1998). The data analysed in manual through some visual inspection to compare the level of stress and sigh of gastritis pain of each subject among the baseline, treatment and follow-up. Results showed that there is decreasesof stress and sigh of gastritis pain of the subjects. They also showed clinical significancy

    ANALISIS PENGOLAHAN KOMODITAS UNGGULAN DI DESA TAWANGHARJO KECAMATAN GIRIWOYO KABUPATEN WONOGIRI = Analysis of Main Commodities Processing in Tawangharjo Village Giriwoyo District Wonogiri Regency

    Get PDF
    Decentralization policies that implemented by central government requires local government to explore the potentialof such area, exampleagroindustry, for supply local needs independently. Thepurposeof this researchis (1) to know the financial feasibility of agricultural commodities views from the employment, B/C ratio and revenue contribution. (2) Looking opportunities of thefarm households economic development through value added and profits of the agroindustry products madefrom rice, maize, soybean and cassava. The method used is descriptive analysis and exploratory. Population taken werefarmers who lives in the Tawanghmjo Village. Total respondents were interviewed are 30 farmers were selected randomly. Respondents of agroindustry are people who made products from rice, maize, soybean and cassava. Then the method of analysis used t -test and analysis of value added The result from financial feasibility indicates that farming by farmers is feasible. Agroindustrial products made from rice, com, soybean and cassava views from value added and profits is deserve to be developed. The household economic of the manggleng agroindustry and tempeh is deserve to be developed Kebijakan desentralisasi yang diterapkan pemerintah pusat mengharuskan pemerintah daerah untuk mencukupi kebutuhan daerahnya secara mandiri salah satu caranya dengan menggali potensi daerah misalnya dengan agroindustri. Tujuan Penelitian ini adalah (I) Mengetahui kelayakan finansial komoditas pertanian dilihat dari peny.erapantenaga kerja, B/C ratio dan kontribusi pendapatan. (2) Melihat peluang pengembangan ekonomi rumah tangga tani melalui nilai tambah dan keuntungan yang dihasilkan oleh produk agroindustri berbahan baku komoditas padi, jagung, kedelai dan ketela pohon. Metode yang digunakan adalah metode deskriptik analisis dan eksploratif. Populasi yang diambil adalah petani yang berada di desa Tawangharjo. Responden petani yang diwawancara adalah 30 petani yang dipilih secara acak sederhana. Responden agroindustri merupakan agroindustri berbahan baku komoditas padi, jagung, kedelai dan ketela pohon. Kemudian, metode analisis yang digunakan adalah t-test dan analisis nilai tambah. Dilihat dari kelayakan fmansial, usahatani yang dilakukan oleh petani layak unuk dikembangkan. Agroindustri berbahan baku komoditas padi, jagung, kedelai dan ketela pohon dilihat dari nilai tambah dan keuntungan layak untuk dikembangkan. Jika dilihat secara keseluruhan, pengembangan ekonomi rumah tangga tani dengan agroindustri manggleng dan tempe layak untuk dikembangkan

    PERBEOAAN KEBOCORAN MIKRO RESIN KOMPOSIT METAKRILAT DAN SILORANE SERTA LETAK DINDING GINGIVAL 01 EMAIL DAN DENTIN RESTORASI KAVITAS KELAS II

    Get PDF
    Penelitian ini bertujuan untuk mengetahui perbedaan kebocoran mikro resin komposit metakrilat dan silorane serta letak dinding gingival di email dan dentin restorasi kavitas kelas II. Subjek penelitian menggunakan 20 gigi premolar maksila, dibagi menjadi 4 kelompok perlakuan, yaitu kelompok A, aplikasi resin komposit metakrilat (A1 pada dinding gingival di email.A2didentin).kelompok 8 aplikasi resin komposit silorane (81 pada dinding gingival di email, 82 di dentin). Subjek penelitian disimpan dalam saliva buatan selama 24 jam dalam inkubator suhu 37°C, dilakukan thermocycling suhu 4-60° C setiap suhu 1 menit diulang selama 25 kali. Tes kebocoran mikro dilakukan dengan cara subjek penelitian direndam dalam larutan biru metilen 2% di dalam inkubator suhu 37°C selama 24 jam dan disentrifus kecepatan 3000 rpm selama 5 menit. Subjek penelitian diamati di bawah mikroskop stereo pembesaran 250 kali dan diberi skor kebocoran mikro 0-4. Analisa data dengan Kruska/-Wallis test (PSO,05)dan tingkat kepercayaan 95% dan dilanjutkan dengan Mann-Whitney V-test. . Hasil penelitian dengan nilai rerata kebocoran mikro kelompok A1 1,3:t: 0,675, kelompok A2 1,60 :t:1,430, kelompok 81 0,80 :t: 0,632, kelompok 82 0,40 % 0,516. Hasil penelitian menunjukkan adanya perbedaan kebocoran mikro yang signifikan antara kelompok A1, A2 terhadap 81, 82. Tidak ada perbedaan kebocoran mikro yang signifikan antara kelompok A1, 81 terhadap A2, 82. Kesimpulan penelitian adanya perbedaan kebocoran mikro antara resin komposit metakrilat dan silorane. Kebocoran terendah pada restorasi resin komposit silorane. Tidak ada perbedaan kebocoran mikro pada restorasi resin komposit kavitas kelas II antara dinding gingival di email dan di dentin

    PENGARUH PREPARASI SALURAN PASAK TERHADAP KEBOCORAN APIKAL PADA OBTURASI SALURAN AKAR MENGGUNAKAN JENIS SILER YANG BERBEDA

    Get PDF
    Penelitian ini bertujuan untuk mengetahui pengaruh preparasi saluran pasak terhadap kebocoran apikal menggunakan jenis siler yang berbeda. Subjek penelitian menggunakan 42 gigi premolar dibagi menjadi 2 kelompok, tiap kelompok terdiri dari 21 gigi dan dilakukan perawatan saluran akar. Masing-masing kelompok dibagi menjadi 3 sub kelompok yang terdiri dari 7 gigi dan diobturasi mengggunakan siler seng oksid eugenol (kelompok IA), siler resin (kelompok 18) dan siler kalsium hidroksida (kelompok IC). Kelompok I di lakukan preparasi saluran pasak dan kelompok II tanpa preparasi saluran pasak. Selanjutnya permukaan akar gigi dilapisi dengan malam perekat satu lapis dua lapis cat kuku kecuali 1 mm dari foramen apikal. Setiap gigi dimasukkan kedalam tabung berisi larutan biru metilen 2% dan disentrifus kecepatan 800 rpm selama 3 menit. Tahap selanjutnya masing-masing kelompok uji di dekalsifikasi dengan larutan asam nitrat 5% selama 3 hari, dehidrasi larutan alkohol 80% selama 12 jam, alkohol 90% selama 1 jam. Tahap terakhir dilakukan clearing dalam larutan salisilat 100% selama 2 jam. Pengukuran kebocoran apikal dapat dilihat adanya penetrasi warna biru metilen terpanjang dari arah apeks ke korona dan pengamatan dilihat menggunakan mikroskop stereo. Hasil penelitian dengan ANAVA dua jalur dan uji LSD menunjukkan bahwa tidak ada pengaruh preparasi saluran pasak terhadap kebocoran apikaJ menggunakan jenis siler yang berbeda (p>0,05) namun ada pengaruh jenis siler terhadap kebocoran apikal (

    10,382

    full texts

    12,430

    metadata records
    Updated in last 30 days.
    UGM Journals, OAI Repository
    Access Repository Dashboard
    Do you manage Open Research Online? Become a CORE Member to access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard! 👇