Indonesian Journal of Biotechnology
Not a member yet
387 research outputs found
Sort by
Identification and genetic study of lactic acid bacteria from intestine of domestic chickens (Gallus gallus domesticus)
No full textThe gastrointestinal tract is one of the habitats of lactic acid bacteria (LAB). This research aims to identify the LAB isolated from the intestines of domestic chickens (Gallus gallus domesticus) based on phenotypic and genotypic characteristics. The LAB was cultivated on enrichment media MRSA + CaCO3 1% and a selection of isolates based on the halo zone. The phenotypic character identification using morphological, physiological and biochemical tests was analyzed by similarity simple matching (SSM) and a dendrogram (MVSP 3.1). Genotypic identification was made by 16S rRNA gene sequences with PCR methods, sequencing and analysis using BLAST at www.ncbi.nlm.nih.gov. The results show that 87 isolates were isolated based on the halo zone. Phenotypic tests were performed on eight isolates (J6, J15, J18, J28, B11, B24, B25 and B26). The results show that four isolates have similarities with the genus Bacillus, two isolates with the genus Lactobacillus, and two with the genus Streptococcus. The identification based on the 16S rRNA gene of four selected isolates (J15, J28, B24 and B26) showed that J15 was identified as Bacillus cereus (98.56% similarity); J28 as Lactobacillus johnsonii (99.67%); B24 as Bacillus cereus (98.30%), and B26 as Streptococcus pluranimalium (96.68%)
Agrobacterium‐mediated transformation of yeast using a vir binary vector system
No full textAgrobacterium‐mediated transformation (AMT) is a widely used genetic engineering tool for generating transgenic plants for crop improvement and functional genomics. Beyond plants, AMT has been successfully applied to non‐plant organisms, further expanding its utility. Given their broad applications, enhancing AMT systems to improve their usability, simplicity, and efficiency is highly desirable. In this study, we developed a novel AMT system, the vir binary vector system, comprising the following core components: the binary vector pG103‐GDE‐1 and the miniaturized helper tumor‐inducing (Ti) plasmid pRIDE101, together with the auxiliary replication helper plasmid pSoup. Yeast was used as a model organism to evaluate its functionality in stable transformation, with the neomycin phosphotransferase II (NptII) gene serving as a selectable marker. The system’s functionality was assessed by comparing its transformation frequency to that of the widely used pGWB1 binary vector system. The results demonstrate that the vir binary vector system achieved a trans‐ formation frequency of 0.76 × 10‐6, approximately 75 percent of that of pGWB1 (1.01 × 10‐6). Polymerase chain reaction (PCR) analyses confirmed the presence of the transgene in yeast transformants. These findings validate the functionality of the vir binary vector system and highlight the need for further optimization to enhance its efficiency for broader ap
Duku peel ethyl acetate extract as an adjunctive treatment of doxorubicin on triple negative breast cancer 4T1 cells
No full textTriple‐negative breast cancer (TNBC) faces significant treatment challenges due to its resistance to chemotherapy and high‐rate metastatic occurrence. Adjunctive treatment is a promising approach to improve chemotherapy effectiveness while reducing toxicity on normal cells. Natural compounds of Lansium domesticum (duku) exhibit potential as adjunctive cancer treatments. This study aims to investigate the potential of duku peel extract (DPE) to be developed as an adjunctive agent. The cytotoxic activity of DPE against 4T1 cells was conducted through MTT assay, both in single and combination treatments. The anti‐migratory effect of DPE was examined by scratch wound healing assay. The molecular mechanism of DPE was confirmed using virtual screening via bioinformatics approaches, including protein target prediction and molecular docking. The results show that DPE has cytotoxic activity with an IC50 value of 47 µg/mL against the 4T1 cell line, in a 24‐hour treatment period. Interestingly, DPE not only had a good synergistic effect (mean CI value, i.e. 0.34), but also showed significant inhibition of cell migration with doxorubicin (Dox). Additionally, virtual bioinformatics screening approaches suggest the potential mechanism of DPE compound action by targeting CDC25B and TOP2A. Overall, DPE holds promise as an adjunctive treatment of Dox against 4T1 TNBC cells
Low pH resistant lactic acid bacteria from cow rumen waste
No full textThis study aims to obtain a new strain of lactic acid bacteria (LAB) with the ability to survive at low pH, resulting from isolation, selection, and identification from rumen waste. The research included four stages: isolation of bacteria from rumen waste, selection, and identification. The selection procedure involved growth of LAB in a low pH medium. Molecular identification procedure was conducted using the 16S rRNA gene sequence amplification method with universal primers 27F (AGAGTTTGATCCTGGCT CAG) and 1429R (TAGGGTTACCTTGTTACGACTT). The results of the isolation and identification were analyzed descriptively, revealing that five petri dishes (5a, 10a, 10b, 16a, and 18b) contained lactic acid bacteria which produced clear zones. Among these, isolate 18b was the only LAB strain that survived in a pH 3.5 medium. The results of the molecular identification using the 16s rRNA gene showed that isolate 18b belonged to Limosilactobacillus fermentum
Green synthesis of hyaluronic acid‐silver nanoparticles using microalgae extracts, with evaluation of antimicrobial activity
No full textSilver nanoparticles (AgNPs) exhibit excellent antimicrobial activity but face challenges such as aggregation and reduced effectiveness when used alone. To address these limitations, green synthesis methods utilizing biological agents as reducing agents have been explored to develop AgNP nanocomposites. This study synthesized AgNPs by incorporating hyaluronic acid (HA) with microalgae extracts from Arthrospira platensis, Chlorella vulgaris, and Nannochloropsis sp., resulting in HA‐AgNP nanocomposites. The experimental parameters, including pH, extract concentration, temperature and synthesis time, were optimized for the preparation of the HA‐AgNPs nanocomposites. The best HA‐AgNPs nanocomposites, synthesized by A. platensis (HA‐SP‐AgNPs), exhibited a Z‐average size of 66.98 nm and polydispersity index (PDI) of 0.494, indicating uniformity and stability. FTIR analysis confirmed the presence of functional groups associated with AgNPs, HA and A. platensis, ensuring structural stability. A key finding of the study is that HA‐SP‐AgNPs demonstrated enhanced antimicrobial activity against bacteria such as Staphylococcus aureus, Escherichia coli, and Bacillus subtilis. Notably, the HA‐SP‐AgNPs were particularly effective against S. aureus and E. coli compared to AgNPs alone. The results underscore the critical role of HA in enhancing nanoparticle stability and antibacterial efficacy, positioning HA‐SP‐AgNPs as a promising antimicrobial agent
Optimization of methanol‐induced expression and His‐tag purification of Saccharomycopsis fibuligera R64 mutant α‐amylase in Pichia pastoris
No full textThe Sfamy R64 α‐amylase mutant from Saccharomycopsis fibuligera was expressed in Pichia pastoris to explore its industrial potential. The gene encoding the mutant enzyme was cloned into the pPICZαA vector and transformed into P. pastoris SMD1168. Optimal expression was achieved at 1.5% methanol concentration, with the highest enzyme activity observed at 48 h, reaching 24.06 U/mL. The recombinant protein was purified using Ni‐Sepharose affinity chromatography in native and denaturing conditions. The native conditions retained higher protein integrity and activity, while the denaturing process resulted in partial degradation. Molecular dynamics (MD) simulations conducted to assess the structural stability of the His‐tagged Sfamy R64 α‐amylase mutant and its interaction with the maltose substrate. The simulation confirmed the stable binding of maltose in the active site and the solvent accessibility of the His‐tag, supporting its effectiveness in affinity chromatography. The RMSD, RMSF, and time‐evolution snapshots demonstrated that the protein remained structurally stable over 100 ns at an optimum temperature of 50 °C. The findings suggest that the Sfamy R64 mutant α‐amylase is a promising candidate for industrial applications, combining high expression yields, efficient purification, and stable enzyme‐substrate interactions. The results offer a strong basis for further optimization and large‐scale enzyme production
Thrombolytic activity and antibacterial activity optimize staphylokinase enzyme production from Staphylococcus aureus
No full textStaphylokinase is a virulence factor produced by Staphylococcus aureus that enhances its ability to degrade proteins, contributing to tissue damage and increased bacterial invasiveness. This investigation studied staphylokinase production by S. aureus isolates obtained from wound and burn patients. Optimal conditions for enhancing staphylokinase production in Sato’s component were determined. These conditions included a carbon source (glucose), a nitrogen source (yeast extract), an inoculum size of 1%, an incubation temperature of 37 °C, and a pH of 7. Optimization of the medium components resulted in a significant increase in staphylokinase production (26.4 U/mL), representing a 2.23‐fold rise compared to production in the unoptimized Sato’s component. The crude staphylokinase enzyme exhibited thrombolytic activity against human blood clots, achieving 42% clot lysis. However, the crude enzyme showed no antibacterial activity against the tested bacteria (Streptomyces and Escherichia coli). This study represents the first report of optimized media for enhancing staphylokinase production from S. aureus. The research is significant because it establishes a method for improving the production of highly active staphylokinase from S. aureus, which has potential applications as a thrombolytic agent
Metagenomic detection and biochemical characterization of a Streptomyces tyrosinase from Mesopotamian marsh soils: Implications for phenolic turnover
No full textWetland soils in southern Iraq store large carbon pools and contain abundant phenolics that can modulate microbial decomposition. In this study, we investigate bacterial tyrosinases (TYRs), type III copper enzymes that oxidize mono‐ and diphenols, in Mesopotamian marsh soils using a combined metagenomic and biochemical approach. Degenerate primers targeting conserved CuA/CuB motifs recovered diverse partial tyr fragments affiliated with Proteobacteria and Actinobacteria. From one sample, we amplified the full melC operon from a Streptomyces lineage; expressed the tyrosinase in E. coli; and purified the enzyme (SZTYR). SZTYR displayed an alkaline pH optimum (~9); retained activity up to ~70 °C; and preferentially oxidized diphenols (e.g., L‐DOPA, dopamine) over monophenols. The enzyme also acted on phenolics relevant to peat/wetland matrices (e.g., caffeic, protocatechuic, p‐coumaric and gallic acids). The results document TYR genetic diversity in Iraqi marsh soils and establish the biochemical profile of an alkaline‐adapted Streptomyces tyrosinase. While ecosystem‐level impacts were not measured, our findings motivate field‐scale assessments of in situ TYR activity, phenolic pools and oxygen/pH dynamics to evaluate potential consequences for phenolic turnover and carbon cycling in aridifying wetlands
Corrigendum to: Antibacterial activity of mycelial extract from a local fungus, Sclerotium rolfsii [Indonesian Journal of Biotechnology, 30, 3, 2025, DOI: 10.22146/ijbiotech.108408]
No full textAuthor Correction:This article has been updated to include I Nyoman Pugeg Aryantha as an additional corresponding author. The authorship and correspondence information in the online version have been corrected accordingly.This correction does not affect the results, analysis, or conclusions of the original article.
Osteogenic induction of human Wharton’s jelly‐derived mesenchymal stem cells using a composite scaffold from poly(ɛ‐caprolactone) and biosilica sponge Xestospongia testudinaria
No full textBone defects occur when bones cannot function properly due to trauma, such as accidents. In Indonesia, such defects are mainly treated by bone grafting, but the limited availability of transplants has led to the development of bone tissue engineering as an alternative. This study uses human Wharton’s jelly‐derived mesenchymal stem cells (hWJ‐MSCs) as these can differentiate into osteoblasts when stimulated by a composite scaffold containing biosilica from the sponge Xestospongia testudinaria. Four main steps were performed in this study, i.e. scaffold fabrication with varying biosilica concentrations, material characterization to see whether the scaffold resembled bone tissue, hWJ‐MSC isolation from the umbilical cord and cultured until passage 6, and scaffold testing to assess its compatibility and ability to support cell adhesion, proliferation, differentiation, and mineralization into bone cells. The results indicated that a scaffold with 50% biosilica has good properties for supporting hWJ‐MSC growth, proliferation, and differentiation. The scaffold exhibits strong mechanical strength and hydrophilic characteristics, enhances cell proliferation, and promotes osteogenic differentiation, as confirmed by collagen type I and osteopontin expression with a higher optical density value in the Alizarin Red assay. Therefore, the 50% biosilica composite scaffold is biocompatible and osteoconductive, making it a promising candidate for bone tissue engineering