Journal of Biota
Not a member yet
606 research outputs found
Sort by
Pengaruh Ragi dan Waktu Fermentasi terhadap Produksi Alkohol Secara Fermentasi Berbahan Baku Gaplek Ubi Kayu (Manihot utillisima)
Full text linkThe research of the ragi and the fermentation time effect on alcohol production by cassava gaplek has been done. The aim of this research were to find out the best time fermentation and trade mark commercial ragi to produce alcohol. Time fermentation were 1 and 2 weeks. The ragi trade marks were NKL and MK. The result showed that the alcohol production was 15-17% in a week, and 18-20% in two week fermentation. The alcohol quantity which produced by both NKL and MK ragi were not significantly different
Understanding Food (Kajian Buku)
No full textKata understanding menarik untuk dipahami, terutama bagi pembaca yang tertarik dan memilih untuk menekuni jalur ilmu di bidang ilmu aplikatif, seperti teknologi pangan. Buku berjudul Understanding Food: Principles and Preparation yang menyajikan informasi mengenai ilmu pangan, gizi, dan food service, baik yang berupa prinsip-prinsip dasar maupun tren terbaru di bidang teknologi pangan menjadi pilihan yang menarik untuk dibaca
Keragaman Daerah Kontrol DNA Mitokondria Rusa Timor (Cervus timorensis timorensis) di Pulau Timor, Alor, dan Pantar
Full text linkA study on mtDNA control region diversity of the timor deer was conducted in EastNusa Tenggara Province. Sample consisted of 20 individuals from 3 islands (Timor,Pantar, and Alor). Total DNA were extracted from leucocyte (buffy coat). Fragmentcontrol region of the mitochondrial DNA were amplified by Polymerase ChainReaction (PCR) using primers of forward primer5”AAACCAGAAAAGGAGAGCAAC3” and reverse primer5”TCATCTAGGCATTTTCAGTGCC3”. Nucleotide sequence of the mitochondrialcontrol region were aligned by using ClastalX and phylogenetic analyses by Neighbor-Joining methode. Kimura two-parameter model of nucleotide substitution usingpairwise distance calculation program was implemented with the Mega softwareversion 3. The purposes of this study, were to examine the control region (D-Loop) ofthe mitochondrial DNA and to discuss the phylogeography of the Cervus timorensistimorensis in East Nusa Tenggara Province. Results indicated that from 435 basenucleotide sequences, 16 polymorphic sites with 8 haplotypes were found among 3islands. Haplotype diversity and nucleotide diversity were 0.056 and 0.039. DNAdistances values ranged from 0.014 to 0.021
Fitoekstraksi Sianida pada Centrosema pubescens Benth yang Tumbuh di Limbah Tailing Terkontaminasi Sianida
Full text linkContamination of mined soil and water affects not only to agriculture system but alsofood chains and epidemiological problems. As soil metal can not be biodegraded,remediation of soil heavy metal risks has been a difficult and expensive goal. Presentlythere are several different strategies available for the clean up and restoration ofcontaminated soils. One approach to minimize risks from some toxic pollutants isphytoextraction using hyperaccumulator plants, known as phytoremediation. In thisresearch Centrosema pubescens was studied to examine its potency ashyperaccumulator against cyanide. Although cyanide is not categorized as heavymetal, its presence is considered as one of important toxic pollutants in theenvironments. Detoxification of cyanide (CN) contaminated soils and waters withplants seems to be a feasible option. Centrosema pubescens which proven tolerant anddominant in the CN contaminated environment was used in this research. The plantswere grown in tailing waste media added by 0, 10, 20 and 30 ppm CN. Different pHlevels were applied, i.e.+ 6 and +5. The results showed that the plants were capable ofgrowing under high level of CN. The results indicated that Centrosema pubescens canbe considered as high tolerance and potentially effective in accumulating CN, i.e up to3.564 ppm in roots and up to 3.564 ppm in shoot with concentration ratio (shoot/root)up to 1.13. The plants also indicated high tolerance by producing high biomass underhigh level of CN, i.e up to 36.517 g (under 20 ppm CN)
Aktivitas Antimutagen Isoflavon Glikosida Hasil Transglikosilasi Enzimatik CGT-ase Bacillus macerans
Full text linkIt has been known that isoflavone have biological activities such as antioxidant, antibacteria, antimutagenesis, and anticancer. Isoflavone aglycone uses such as genistein, daidzein and glycitein are limited since they are unstable and uneasily to dissolve in water. Through enzymatic transglycosylation reaction, its stability and solubility could be improved. In this study, genistin (isoflavone glycoside) was synthesized from genistein (isoflavone aglycone) by application of transfer reaction using enzyme cyclodextrin glucanotransferase (CGT-ase) of Bacillus macerans. Identification of the product was determined by TLC with methanol: chloroform (1:3, v:v) as eluent. Rf value 0.75 of the synthesized product was close to the Rf value standard of authentic genistin glycoside. The synthesized genistin was furthermore assayed to determine its antimutagenesis activity according to the Ames methode on E. minimal glucose media had been precultured with a mutant strain of Salmonella thypimurium TA98. The tested bacterial strain was induced with aflatoksin B1 as mutagen which had been activated with a lever homogenate. The result showed that the solubility and some biological properties of the synthesized genistin were improved higher than that of genistein, while it was found to be lower than that of the commercial genistin
Dampak Deraan Kekeringan p ada Fase Inisiasi Bunga, Fase Berbunga dan Fase Pembentukan Polong t erhadap Pembentukan Bunga dan Buah p ada Empat Varietas Vigna radiata
Full text linkOne of the greatest affected factors toward the growth of V. radiata is considered as the availability of water. Obviously, less production of V. radiata is due to short water supply. This research shows that flower initiation, flowering and fruiting to reproduction of four V. radiata varieties (Belu, Kenari, Perkutut and Murai), affected by drought are taken under this investigation. Based on numbers of initiated pod flowers and pods being produced, the most sensitive reproduction stages to drought in Belu variety were flower initiation and flowering, Kenari variety were flowering, Murai variety were flowering and fruiting, and Perkutut variety in all reproduction stages posses relatively similar level of sensitivity to drought. Generally, number of flowers initiated pods and the number of pods produced were higher in Kenari and Murai varieties compared to those on Perkutut and Belu. Based on numbers of flowers initiated pods and numbers of pods production, drought at flower initiation and flowering stage were more highly affected on Belu and Perkutut varieties compared to that of Kenari and Murai. Droughts on fruiting stage are highly affected on Perkutut varieties as well compared to other varieties. Therefore, based on plants production and their tolerance to drought, the best plants to be cultivated are Kenari and Murai