Indonesian Journal of Pharmacy
Not a member yet
378 research outputs found
Sort by
Formulation And Optimization Peel-Off Gel Mask with Polyvinyl Alcohol and Gelatin Based Using Factorial Design from Banana Peel Flour (Musa paradisiaca L) As Antioxidant
Get PDFBanana peel (Musa paradisiaca L) contains flavonoid compounds that act as an antioxidant that has the potential to be developed into cosmetic preparations such as peel-off gel masks. This study aims to determine the effect of variations in the concentration of banana peel flour, PVA, and gelatin on the physical properties of peel-off gel masks and to determine their antioxidant activity. This study uses a factorial design of 23 where the factors used are the concentration of banana peel flour, PVA, and gelatin with 2 levels. Based on the results of data analysis, it was found that there was a significant effect of each factor and the interaction between factors on the spreadability and drying time of the preparation (p<0.05). F5 with a concentration ratio of banana peel flour, PVA, and gelatin of 5:12:5 was chosen as the optimum formula and continued to antioxidant activity test compared to F4 which had a ratio of concentrations of banana peel flour, PVA, and gelatin of 10:14:3. The antioxidant activity produced by F5 was better than F4 with IC50 values of 525.41 and 355.64 ppm, respectively. It can be concluded that the optimization of the dosage formula will affect the activity of the active substance
Application of Molecular spectroscopy and chemometrics for authentication and quality control of tea (Camellia sinensis L.): a review
Get PDFTea, derived from Camellia sinensis L., is considered as the most popular beverages in the world. The quality of teas may vary depending on harvesting location and geographical origins, thus the traceability of teas according to their origins is very essential to assure tea’s quality. Due to economic reasons, high quality tea products may be added with foreign materials or adulterated with low quality ones, as a consequence, some analytical methods have been proposed and developed to quality control of tea. During the recent years, the application of molecular spectroscopic techniques (UV-Vis, Fluorescence, Near Infrared, Mid Infrared, Raman) in combination with multivariate data analysis has emerged as rapid and reliable analytical tool in the quality control of food, including food authentication. The objective of this review is to update the application of molecular spectroscopy (UV-Vis, fluorescence, infrared and Raman) for the quality control and authentication of tea products either geographical origins issue or detection of potential adulterants. The variables obtained during molecular spectral measurement involve hundreds or thousands of data, which make data analysis rather complex. Fortunately, the specific chemometrics tools can solve the problems arising from big data coming from analyte signals, spectral interferences and overlapping peaks. This review paper provides an overview of the recently developed approaches and latest research carried out in molecular spectroscopic techniques in combination with chemometrics for the quality control and for authentication of tea
Somatostatin Analog-Based Radiopharmaceuticals for Molecular Imaging and Therapy of Neuroendocrine Tumors
Get PDFSomatostatin receptors (SSTRs) are overexpressed in a wide variety of cancers such as neuroendocrine tumors (NETs), but the expression in normal cells is relatively low. Therefore, SSTRs serve a potential target for molecular imaging and therapeutic applications of NETs. This review presents the development of somatostatin analog-labeled with gamma-emitting radionuclides such as 111In, 99mTc, and 123I for the visualization of NETs via single-photon emission tomography (SPECT). Additionally, the development of somatostatin analog-radiolabeled with positron emitting radionuclide such as 68Ga for the molecular imaging of NETs with positron emission tomography (PET) is also presented herein. Moreover, this review describes 177Lu-, 90Y-, and 111In-labeled somatostatin analogs as peptide receptor radionuclide therapy (PRRT) agents for the therapeutic application of NETs. These radiolabeled-somatostatin analogs showed promising results with good images quality and high tumor uptake. These results highlight the potential application of radiopharmaceuticals-based somatostatin analogs for the molecular imaging and targeted treatment of NETs
Chemical composition of Bryophyllum pinnatum (Lam.) Oken
Get PDFNatural chemicals with medicinal qualities are an endless source of chemical molecules, making them a valuable source of pharmacologically active molecules. Humans have always looked for these plants, not only for food but also for medicinal purposes. Bryophyllum pinnatum is a succulent perennial herb native to Africa and Asia. The plants is traditionally used in northern Nigeria for the treatment and management of various ailments. To date, no studies have been carried out on the chemical composition of B. pinnatum in Northern, Nigeria. The study examine the chemical composition of B. pinnatum leaves in Northern, Nigeria. Hydrodistillation was used to extract the essential oil using three different solvents (dichloromethane, hexane and hexane-acetone). The chemical composition of the essential was identified with Gas chromatography coupled with mass spectrometry. Thirty five compounds were identified from the essential oil extracted with dichloromethane, twenty five compounds from the essential oil extracted with hexane and twenty three compounds from essential oil extracted hexane-acetone. But the three solvents were found to be dominant by Bis(2-ethylhexyl) phthalate. The study provides the first chemical composition of B. Pinnatum which can be fully utilised industry and pharmaceutical companies. Further studies is needed to ascertain the pharmacological and industrial usage of each identified compound
Comparison of the Mortality and Bleeding Risk of Anticoagulant Doses in COVID-19 Patients: A Systematic Review and Meta-analysis
Get PDFAnticoagulant therapy becomes critical to preventing further complications caused by the hypercoagulative state in COVID-19 patients. The optimal dose and time-dependent administration of anticoagulants remains unknown. The purpose of this study was to determine the mortality and bleeding risks of anticoagulants administered to COVID-19 patients. We collected data from articles that compared prophylactic and therapeutic anticoagulants in COVID-19 patients recorded online from studies that were published around 2020 to 2021. We were taking the articles from a scientific database such as ScienceDirect, Cochrane, ProQuest, PubMed, and Google Scholar based on the inclusion criteria. Data analysis was conducted using Review Manager Version 5.4.1 (Cochrane, Copenhagen, Denmark) using Mantel-Haenzel statistical method for categorical data to measure Relative Risk (RR) and 95% Confidence Interval (CI). We use a random-effect analysis model if P for heterogeneity (pHet <0.1) and a fixed-effect analysis model if pHet ≥0.1. Based on time dependent-manner, therapeutic anticoagulant showed no benefit in reducing mortality (RR = 0.69; 95% CI = 0.47 to 1.02). Beside, based on dose-dependent manner, prophylactic anticoagulant was found beneficial to prevent mortality (RR = 0.49; CI 95%; p = 0.02) compared to therapeutic. Therapeutic anticoagulants also showed higher risk of bleeding (RR = 0.27; CI 95%; p < 0.000001) compared to prophylactic. Therapeutic have no significantly benefit over prophylactic dose in reducing mortality rates. Therapeutic anticoagulant has a higher risk of bleeding in patients with COVID-19. Administer prophylactic dose is recommended due to the fewer side effects compared to the therapeutic dose
Anti-Aging Face Cream Preparations Made from Collagen Membrane Chicken Eggshell (Gallus gallus domesticus) Combined with Bee Honey (Apis mellifera)
Get PDFHandling waste such as chicken egg shells requires innovation to be able to provide added value as a sustainable product. This study aims to extract collagen from chicken egg shell membranes combined with bee honey as an anti-aging face cream. This material has a very high model accuracy value (97.89%) which has the potential to inhibit aging due to Matrix metalloproteinase-1 (MMP-1). This research was carried out by extracting eggshell membrane collagen, making cream combined with bee honey, analyzing product properties, and interpreting virtual data. The results show that in 100 g of face cream formulation with active ingredients of chicken eggshell membrane collagen extract 4.1206% and bee honey 5.0251%; 77.0926% water; 0.0062% ash; 1,8690% protein; 0.0058% fat, the viscosity value was 65.94 dPas, and the pH was 7.08. Thus, this product did not irritate the skin of the experimental animals. The average value of attribute assessment (such as aroma, consistency, texture, stickiness, homogeneous sensation, color, appearance, itching, erythema, washing power, response after washing) was well received by the panelists with a score of 1-3,9 and the highest total achievement bacteria 25 CFU/g and yeast-mold 16 CFU/g met the skin moisturizer quality requirement (SNI 16-4399-1996) which should not exceed 102 CFU/g
Nanoencapsulated formulation of antibacterial metabolites by soil actinomycete, Nocardia sp. TP5 from Tangkuban Perahu Mountain, West Java, Indonesia, with The ionic gelation technique using Na alginate
Get PDF Formulation of nanoencapsulation of antibacterial metabolites from the fermentation of actinomycete strain designed as TP5 has been carried out. Nanoencapsulated formulations performed with Na alginate polysaccharides obtained from brown seaweed can maintain the antibacterial metabolite activity. This study aims to enhance antibacterial activity in nanoencapsulated formulations of antibacterial metabolites with ionic gelation technique using Na alginate and CaCl2. The nanocapsules were prepared by combining the extracellular secondary metabolite Nocardia sp. TP5 with the encapsulation sourced from Na alginate and CaCl2 by ionic gelation technique. The manufacturing methods include fermentation of Nocardia sp. TP5, nanoencapsulated formulation by varying the concentration and ratio of Na alginate, CaCl2, antibacterial metabolites, as well as analysis of nanocapsules. The analysis and characterization of nanoencapsulation using SEM-EDS and PSA included: surface morphology, particle size, chemical constituents, and zeta potential, as well as antibacterial testing against Escherichia coli and Staphylococcus aureus. The results showed that the best-nanoencapsulated formula contains the composition of Na alginate 0.3%, CaCl2 0.06% with a ratio of Na alginate: CaCl2: antibacterial metabolite is 2: 4: 1. The capsule particles formed are evenly distributed over the entire surface with a particle size of 425 nm, zeta potential of -27 mV, and antibacterial activity inhibited the growth of E. coli and S. aureus by 20 and 21 mm, respectively. The variation of the appropriate concentration ratio of Na alginate and CaCl2 greatly affects the uniform nanocapsules size and increases the antibacterial activity
Utilization of UV-visible and FTIR spectroscopy coupled with chemometrics for differentiation of Indonesian tea: an exploratory study
Get PDFUltraviolet (UV)-visible and Fourier-transformed infrared (FTIR) spectroscopy are two of the most popular and readily available laboratory instruments. Fingerprinting analysis of the UV-visible and FTIR spectra has been applied for food classification and authentication studies. In this study, the UV-visible and FTIR spectra of brewed tea, and their data fusion data sets, were used to build models for the classification of tea based on tea types and origins. The study included black and green tea samples from several provinces in Sumatra and Java Islands (Indonesia). Chemometric models of principal component analysis (PCA), k-nearest neighbor (kNN), and logistic regression were developed for classification purposes. All PCA models were able to well-separate the tea groups. kNN and logistic regression models based on UV-visible spectra successfully classified green and black tea with >0.8 classification accuracy. The kNN model of FTIR spectra had good accuracy (0.903) for classifying tea based on its origin. ReliefF algorithm was employed to select the best features among the data fusion data sets of UV-visible and FTIR spectra. The data fusion data sets of UV-visible and FTIR spectra demonstrated good separation of tea types and origins with a high area under the ROC curve (>0.8) and moderate accuracy (0.548). Therefore, UV-visible and FTIR spectroscopy may provide complementary information for tea classification based on tea types and origins
Development of Warfarin Safety Monitoring System at Primary Health Care grounded on Chronic Care Model
Get PDFWarfarin, an anticoagulant with high risk on the fatal adverse effects, the safety monitoring system in primary health care is needed for patients in the community. This study aimed to investigate problems of warfarin use, to discover factors related to the blood clotting, and to develop a safety monitoring system for warfarin. A mixed method was conducted in two phases. Phase one consisted of home visit for 104 patients with warfarin which aimed to investigate use problems. Phase two; the focus groups included all stakeholders were done which aimed to develop a community-based system grounded on the Chronic Care Model (CCM). The warfarin monitoring system was implemented for a month and briefly evaluated the stakeholders’ satisfaction on it. The results revealed that: Phase one, 38.5% patients with warfarin at home had missed their treatment appointments. Their warfarin compliance was 91.1+21.3%. 53.5% had unused warfarin at home; 37.4% had inappropriate warfarin storage; 13.1% suffered the side effect of minor bleeding; 17.3% potentially had warfarin-herb interactions; 61.3% experienced drug-warfarin interaction. Two factors significantly affecting on the International Normalized Ratio (INR) and %Time in Therapeutic Range (%TTR) were inappropriate warfarin dosages and taking other medications. %TTR was influenced by warfarin compliance. Stage two, the safety monitoring system and protocol were created using CCM. The developed system composed of six elements that were joint operation of primary health care personnel and inter-professional team of the hospital. This promoted the continuity of services from hospital to community. After one-month implementation by an inter-professional team, all three groups of stakeholders were satisfied with its results. We concluded that the main problem afflicting warfarin patients was missed treatment appointments. Receiving extra medicines from other services, inappropriate dosage, and non-compliance. The developed warfarin monitoring system covered patients in primary health care, and all stakeholders were satisfied on its outcomes
The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy
Get PDFGelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy