572 research outputs found
Sort by
NTFPs in India: Rhetoric and Reality
No full textIndia is a vast, ecologically and culturally diverse, and densely populated country. While the perctentage of forest cover is not very high (16-19 per cent) and many parts of these forests are in various stages of degradation, forests are a vital resource: for many communities. State policies on forests, other common land and NTFPs, and the implementation of these policies. therefore have a significant impact on rural livelihoods as well as forest condition. A changing agrarian and indlatrial context further influences the role that NTFP collection can play in rural livelihoods. Analysing current policies and practices provides important insights about the possible role for NTFPs in rural
development This chapter seeks to do so by using macro-level analyses across several states and detailed case studies
Some pathological effects and transmission potential of a microsporidian isolate (Nosema sp.) from the teak defoliator Hyblaea puera (Lepidoptera: Hyblaeidae)
No full textWe report here the pathological effects of a microsporidian isolate (Nosema sp.)
from the lepidopteran teak defoliator Hyblaea puera Cramer. The spores were
ovo-cylindrical and had a mean size of 5.1 £ 2.8 mm. The midgut and fat body were the
primary organs infected by the microsporidium. Subsequently, infection was observed in
Malphigian tubules, tracheal epithelium and gonads. The sequence of infection observed
was: midgut – fat body – tracheal membrane – Malpighian tubule – gonad. Infection of
this microsporidium produced a marked negative effect on the growth and development
of larvae. The weight of healthy larvae increased about 22 times from the 3rd instar to
pupation while the increase was about 12 times in the infected larvae. Rearing experiments
conducted in the laboratory revealed a high potential for horizontal transmission (.90%)
of the microsporidium among the defoliator larvae developing together. A nearly equal
degree of vertical transmission (88.7%) was also observed from the infected females to
the progeny larvae. The observations reported here indicate the prospect of the
microsporidium as a bio-control agent against the defoliator pest if exploited properly.
Small subunit rRNA gene sequence analysis revealed that this microsporidium differed
from Nosema bombycis of silk moth by only two nucleotides. The teak moth and the silk
moth are not as closely related as these two parasites appear to be, implying the likelihood
of host switching
Virulence of MetarhiziumM isolates against the polyphagous defoliator pest, Spilarctia obliqua (Llepidoptera: Aarctiidae)
No full textSpecies of the entomopathogenic fungus Metarhizium are some of the most promising biocontrol agents against Lepidopteran pests. Laboratory bioassays were conducted to study the virulence of five isolates of Metarhizium sp. against larvae of the polyphagous pest, Spilarctia obliqua (Lepidoptera: Arctiidae). The Metarhizium isolates used in the study were recovered from soil and various insect hosts belonging to Lepidoptera, Coleoptera and Isoptera. Initially, a preliminary assay was carried out involving 18 Metarhizium isolates at a spore concentration 107 conidia ml-1 and five isolates, MIS 1, MIS 2, MIS 3, MIS 8 and MIS 9, which caused more than 50% mortality were chosen for the detailed bioassay. The assay was carried out with four different spore concentrations of each isolate, ranging from 104-107 conidia ml-1. The lethal concentration LC50 of these five isolates ranged from 2.1 × 105 to 38.9 × 105 conidia ml-1. The lethal time LT50 of the isolates ranged from 7.0-8.1, 6.0-7.7, 5.1-6.7, 4.6-5.4 days at concentrations 1 × 104, 1 × 105, 1 × 106, 1 × 107 conidia ml-1 respectively. The most pathogenic among the five isolates was the MIS 2 isolate with the lowest LC50 of 2.11 × 105 conidia ml-1 and LT50 of 4.6, 5.1, 6.0 and 7.0 days respectively at concentrations 1 × 107, 1 × 106, 1 × 105, 1 × 104 conidia ml-1. Isolate MIS 3 was second in effectiveness. These two isolates showed promise for use as biocontrol agents against S. obliqua
Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools
No full textEthnopharmacological relevance: Phyllanthus (Euphorbiaceae) species are well known for their hepatoprotective activity and are used in several ethno-medicines in indigenous health care systems in India.
Aim of the study: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. Materials and methods: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morphotaxonomic keys. These identities were further validated by developing species specific DNA barcode
signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted
and amplified using the forward (psbAF GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR –
CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Results: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Conclusion: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH
region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve
species admixtures in the raw drug trade of Phyllanthus
Ringing out the old: urban ecology
Get PDFBangalore has the privilege of being home to two historic gardens, Lalbagh, which dates back to Hyder Ali’s administration and created in the 18th century, and Cubbon Park, formed in the 19th century by the British administration. The diversity of plant species that these parks harbour dates at least as far back as 1891, when a book written by John Cameron, Catalogue of Plants in the Botanical Garden, Bangalore (Second Edition) lists a mind-boggling 3,222 species of plants found in Lalbagh. These include as many as 258 varieties of roses, and 122 varieties of crotons! Lalbagh and Cubbon Park occupy a specific place in the city that is unmatched by other public gardens, because of their size, the age of the trees, and the rich diversity of plant species. What of the city’s other parks, though
Street trees in Bangalore: Density, diversity, composition and distribution
No full textOnce renowned as India’s “garden city”, the fast growing southern Indian city of Bangalore is rapidly losing tree cover in public spaces including on roads. This study aims to study the distribution of street trees in Bangalore, to assess differences in tree density, size and species composition across roads of different widths, and to investigate changes in planting practices over time. A spatially stratified approach was used for sampling with 152 transects of 200 m length distributed across wide roads (with a width of 24 m or greater), medium sized roads (12–24 m) and narrow roads (less than 12 m). We find the density of street trees in Bangalore to be lower than many other Asian cities. Species diversity is high, with the most dominant species accounting for less than 10% of the overall population. Narrow roads, usually in congested residential neighborhoods, have fewer trees, smaller sized tree species, and a lower species diversity compared to wide roads. Since wide roads are being felled of trees across the city for road widening, this implies that Bangalore’s street tree population is being selectively denuded of its largest trees. Older trees have a more diverse distribution with several large sized species, while young trees come from a less diverse species set, largely dominated by small statured species with narrow canopies, which have a lower capacity to absorb atmospheric pollutants, mitigate urban heat island effects, stabilize soil, prevent ground water runoff, and sequester carbon. This has serious implications for the city’s environmental and ecological health. These results highlight the need to protect large street trees on wide roads from tree felling, and to select an appropriate and diverse mix of large and small sized tree species for new plantin
Remotely sensed spectral heterogeneity as a proxy of species diversity: Recent advances and open challenges
No full textEnvironmental heterogeneity is considered to be one of the main factors associated with biodiversity given
that areas with highly heterogeneous environments can host more species due to their higher number of available niches. In this view, spatial variability extracted from remotely sensed images has been used as a proxy of species diversity, as these data provide an inexpensive means of deriving environmental information for large areas in a consistent and regular manner. The aim of this review is to provide an overview of the state of the art in the use of spectral heterogeneity for estimating species diversity. We will examine a number of issues related to this theme, dealing with: i) the main sensors used for biodiversity monitoring, ii) scale matching problems between remotely sensed and field diversity data, iii) spectral heterogeneity measurement techniques, iv) types of species taxonomic diversity measures and how they influence the relationship between spectral and species diversity, v) spectral versus genetic diversity, and vi) modeling procedures for relating spectral and species diversity. Our review suggests that remotely sensed spectral heterogeneity information provides a crucial baseline for rapid estimation or prediction of
biodiversity attributes and hotspots in space and time
Estimating breeding pair densities of the Indian fox in Kutch, Gujarat, India
No full textThe availability and use of denning sites are important aspects of the ecology of most canids and indicative of breeding units within the habitat. In this paper we discuss the breeding den densities of the Indian fox Vulpes bengalensis in a primarily scrub habitat in
Kutch, Gujarat, India along with den site observations
that were made during the study. Density of breeding units/km2 was estimated as 11 ± 1.66 (SE) during the 2005 breeding season. We suggest that, since denning in the
Indian fox is restricted to the breeding season, density of breeding units can be used as an effective tool for estimating reproductive success over the years for population monitoring
Our biodiversity, our life, our future: What can arrest the steady decline of our ecosystems?
Get PDFLife is unique to our planet. It is earth's most precious asset. And there is plenty of it. We do not know the exact number of species: many estimates range from 10 to 12 million. India may have close to a million species, the vast majority of which remain to be named or described. These hundreds and thousands of species in India live in many different types of ecological communities or ecosystems spread from deep seas to mountain tops
Coexistence of Fisheries with River Dolphin Conservation
No full textFreshwater biodiversity conservation is generally perceived to conflict with human use and extraction
(e.g., fisheries). Overexploited fisheries upset the balance between local economic needs and endangered
species’ conservation. We investigated resource competition between fisheries and Ganges river dolphins
(Platanista gangetica gangetica) in a human-dominated river system in India to assess the potential for their
coexistence. We surveyed a 65-km stretch of the lower Ganga River to assess habitat use by dolphins (encounter
rates) and fishing activity (habitat preferences of fishers, intensity of net and boat use). Dolphin abundance
in the main channel increased from 179 (SE 7) (mid dry season) to 270 (SE 8) (peak dry season), probably
as a result of immigration from upstream tributaries. Dolphins preferred river channels with muddy, rocky
substrates, and deep midchannel waters. These areas overlapped considerably with fishing areas. Sites with
2–6 boats/km (moderately fished) were more preferred by dolphins than sites with 8–55 boats/km (heavily
fished). Estimated spatial (85%) and prey–resource overlap (75%) between fisheries and dolphins (chiefly
predators of small fish) suggests a high level of competition between the two groups. A decrease in abundance
of larger fish, indicated by the fact that small fish comprised 74% of the total caught, may have intensified the
present competition. Dolphins seem resilient to changes in fish community structure and may persist in overfished
rivers. Regulated fishing in dolphin hotspots and maintenance of adequate dry season flows can sustain
dolphins in tributaries and reduce competition in the main river. Fish-stock restoration and management,
effective monitoring, curbing destructive fishing practices, secure tenure rights, and provision of alternative
livelihoods for fishers may help reconcile conservation and local needs in overexploited river systems