ZENODO

ZENODO
Not a member yet
    3594064 research outputs found

    sRNA_seq_clean_thrips_leafdiscs_timeseries

    No full text
    <p>2023-03 Timeseries experiment with clean thrips on leafdiscs of tomato MoneyMaker plants. srna and mrna were extracted with the kit 'NucleoSpin miRNA, Mini kit for miRNA and RNA purification'.<br> contains (see metadata file for more info):</p> <p>- 20x leafdiscs samples as controls (5 biological replicates/wells for 4 timepoints: 3h, 6h, 9h, 12h)</p> <p>- 20x leafdiscs samples with thrips (5 biological replicates/wells for 4 timepoints: 3h, 6h, 9h, 12h)</p> <p>- 5x whole thrips feeding on leafdiscs for 12h (same experiment, as leafdiscs)</p> <p>- 2x the heads of thrips feeding on tomato for 24h+, i.e. salivary glands enriched samples</p> <p>- 2x the eggs of thrips</p> <p>Barcoded Small RNA-Seq libraries were generated from the small RNA according to the manufacturers’ protocols using the Small RNA-Seq Library Prep Kit (Lexogen). The size distribution of the libraries with indexed adapters was assessed using a 2200 TapeStation System with Agilent D1000 ScreenTapes (Agilent Technologies). The libraries were quantified on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) using the NEBNext Library Quant Kit for Illumina (New England BioLabs) according to the instructions of the manufacturer. The libraries were clustered and sequenced (75 bp) on a NextSeq 550 Sequencing System (Illumina) using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina). </p> <p>Adapter: TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC</p&gt

    PoC implementation of REMEDY (S&P 2022)

    No full text
    <p>This is an artifact of our paper titled "Repairing DoS Vulnerability of Real-World Regexes" (S&P 2022). The artifact consists of an OVA file that stores a PoC implementation of REMEDY described in our paper. To use this, import the OVA file into VirtualBox.</p&gt

    data_farmer

    No full text
    <p>data bee settat</p&gt

    Distance matrix showing the distance between twenty-three eight most similar sequences from NCBI GenBank.

    No full text
    <p>Distance matrix showing the distance between twenty-eight most similar sequences from NCBI GenBank.</p&gt

    IFNa treated and untreated PV and Healthy Control scRNAseq Data

    No full text
    <p>A single cell RNA sequencing data set consisting of 3 healthy controls and 3 Polycythemia Vera. For each patient, a interferone alpha treated and untreated sample is included, for a total of 6 samples. The cells were preprocessed and clustered using Seurat.</p&gt

    REFLEXÕES E EXPERIÊNCIAS EM CIÊNCIAS SOCIAIS

    No full text
    <p><span>"Reflexões e Experiências em Ciências Sociais" oferece uma imersão profunda nas vivências e desafios enfrentados por estudantes e professores do Programa de Residência Pedagógica em Sociologia da UNIVASF. Entre novembro de 2022 e abril de 2024, esses educadores exploraram temas cruciais como inclusão, cooperativismo, e democracia, desenvolvendo práticas pedagógicas inovadoras e reflexões teóricas que dialogam com as realidades das escolas-campo de Petrolina (PE) e Juazeiro (BA). Este livro é um testemunho inspirador do poder transformador da educação e um guia para quem busca promover uma sociedade mais justa e igualitária.</span></p&gt

    Database of indicators of socio-economic development of the regions of the Greater Altai in the post-Soviet period

    No full text
    <p>As part of the research work "Altai vector of Eurasian economic integration: cross-border challenges, effects, strategic objectives and priorities for the Altai Krai" (FZMW-2023-0015), the task was to develop a database of indicators of development of cross-border regions of Russia, Kazakhstan, Mongolia and China for the period 1990-2021. To solve the task, statistical data from official sources were used. The database contains 68 indicators of socio-economic development of the Greater Altai region, grouped into 10 structural blocks. The temporal resolution of the data is 1 year. The data were preliminarily analyzed for outliers and inconsistencies. On the basis of econometric methods, processing was performed to restore short-term gaps in the time series of the data. The generated database represents a unique set of socio-economic and climatic indicators for the transboundary study area, allowing to solve the problems of modeling and analysis of agricultural production dynamics in the post-Soviet period.</p><p><strong>Study Area</strong></p> <p>Official publications and databases of national statistical authorities [1-4], including periodicals [5], regional statistical yearbooks [6, 7], spatial data of the WorldClim project (WorldClim.org) with a resolution of 0.25 sec/pixel, aggregated at the level of the studied regions, were used as sources for database creation.</p> <p>The studied area of the Greater Altai is represented by sixteen regions in four countries:</p> <p><em>Russia</em> (3 regions) - Altai Krai, Altai Republic, Tyva Republic;</p> <p><em>Mongolia</em> (5 aimags) - Bayan-Ulgii, Govi-Altai, Zavkhan, Uvs, Hovd;</p> <p><em>China </em>(5 regions) - Xinjiang Uygur Autonomous Region, Changji-Huei Autonomous Prefecture, Ili-Kazakh Autonomous Prefecture, Altai Autonomous Prefecture, Boro-Tala-Mongol Autonomous Prefecture;</p> <p><em>Kazakhstan</em> (3 regions) - Eastern Kazakhstan Oblast, Pavlodar Oblast, Almaty Oblast.</p> <p>Taking into account the ambiguity of the identification of the territorial boundaries of the transboundary region "Greater Altai", the data are summarized in three levels depending on the coverage of the territory:</p> <p>Greater Altai 1 (GA1) - represents the Greater Altai macro-region, which includes the main and adjacent transboundary regions of the Altai Mountains, including the territory of the Xinjiang Uygur Autonomous Region.</p> <p>Greater Altai 2 (GA2) - regions of cross-border economic cooperation.</p> <p>Greater Altai 3 (GA3) - mountain regions concentrated around the Altai Mountains. This level includes all the studied regions of Russia, the East Kazakhstan Oblast of the Republic of Kazakhstan, the Uvs, Bayan-Ulgiy and Hovd aimags of Mongolia, and the Altai district of the Xinjiang Uygur Autonomous Region.</p> <p><strong>Indicators</strong></p> <p>The database contains 68 indicators grouped into 10 structural blocks: basic indicators - 1 indicator; demography - 6 indicators; social welfare of the population - 5 indicators; social infrastructure - 3 indicators; agricultural land use - 16 indicators; agricultural and animal productivity - 4 indicators; agricultural production - 8 indicators; regional economy - 3 indicators; price indices - 7 indicators; climate - 15 indicators.</p> <p>The database is presented in the form of a Microsoft Excel book with a series of interactive tables containing structured datasets, including statistics of indicator changes by decade and overall for the period.</p> <p>Each indicator was analyzed for outliers, insufficient variation, and the presence of steps. Outliers in the data were analyzed and corrected by smoothing methods. Short-term outliers (not more than 5 years) in the data were restored by linear interpolation, some indicators in view of their absence (mainly in Aimags of Mongolia) for a number of years were estimated on the basis of econometric methods using identified regression dependencies for a certain period with accuracy assessment. It should be noted that modern data processing methods, such as those used by FAO (FAOSTAT), are also based on methods for recovering missing data from trends or based on econometric relationships between indicators. Data are labeled as corrected (1/0), where 1 is data without correction and 0 is data that have been corrected or reconstructed for omissions. The use of such labels allows filtering the data set according to the tasks to be solved.</p> <p>The developed database represents a unique set of data and can be used to solve the problems of analyzing the dynamics of land use at different stages of development of socio-economic systems in the post-Soviet period, analyzing the role of climatic factors in the development of regional economies of the Greater Altai, modeling the effects of climate change on agricultural production, assessing the degree of integration of regional economies in the field of agricultural production, and others.</p><p><strong>Access to the database is possible by agreement with the authors.</strong></p> <p><strong>Acknowledgements. </strong>This work was financially supported by the research project "Altai vector of Eurasian economic integration: cross-border challenges, effects, strategic objectives and priorities for the Altai Krai"  (FZMW-2023-0015).</p><p><strong>Аннотация</strong></p> <p>В рамках научно-исследовательской работы «<em>Алтайский вектор евразийской экономической интеграции: вызовы трансграничности, эффекты, стратегические задачи и приоритеты для Алтайского края</em>» (FZMW-2023-0015) была поставлена задача разработать базу данных показателей развития трансграничных регионов России, Казахстана, Монголии и Китая за период 1990-2021 гг. Для решения поставленной задачи были использованы статистические данные из официальных источников. База данных содержит 68 показателей социально-экономического развития регионов Большого Алтая, группированных в 10 структурных блоков. Временное разрешение данных – 1 год. Данные были предварительно проанализированы на предмет наличия выбросов и несогласованностей. На основе эконометрических методов выполнена обработка по восстановлению краткосрочных пропусков во временных рядах данных. Сформированная база данных представляет уникальный набор социально-экономических и климатических индикаторов для трансграничной территории исследования, позволяющая решать задачи моделирования и анализа динамики сельскохозяйственного производства в постсоветский период.</p><p><strong>Цель разработки</strong></p> <p><strong>Ц</strong>елью работы является разработка база данных индикаторов динамики социально-экономического развития трансграничных регионов Большого Алтая за период 1990-2021 гг.</p> <p> </p> <p><strong>Территория исследования</strong></p> <p>В качестве источников формирования базы данных использованы официальные публикации и базы данных национальных органов статистики [1-4], включая периодические издания [5], региональные статистические ежегодники [6, 7], пространственные данные проекта WorldClim (WorldClim.org) разрешения 0,25 сек./пиксель, агрегированные на уровень рассматриваемых регионов.</p> <p>Исследуемая территория Большого Алтая представлена шестнадцатью регионами в четырёх странах:</p> <p><em>Россия</em> (3 региона) – Алтайский край, Республика Алтай, Республика Тыва;</p> <p><em>Монголия</em> (5 аймаков) – Баян-Улгий, Говь-Алтай, Завхан, Увс, Ховд;</p> <p><em>Китай</em> (5 регионов) – Синьцзянь-Уйгурский автономный район, Чанцзи-Хуэйский автономный округ, Или-Казахский автономный округ, округ Алтай (находится в подчинении Или-Казахского автономного округа), Боро-Тала-Монгольский автономный округ;</p> <p><em>Казахстан</em> (3 региона) – Восточно-Казахстанская область, Павлодарская область, Алматинская область.</p> <p>Учитывая неоднозначность идентификации территориальных границ трансграничного региона «Большой Алтай», данные обобщены на три уровня в зависимости от охвата территории:</p> <p><em>Большой Алтай 1</em> (GA1) – представляет макрорегион Большой Алтай, включающий в себе основные и сопредельные трансграничные регионы Горного Алтая, включая территорию Синьцзянь-Уйгурского Автономного района.</p> <p><em>Большой Алтай 2</em> (GA2) – регионы трансграничного экономического сотрудничества.</p> <p><em>Большой Алтай 3</em> (GA3) – горные регионы, концентрирующиеся вокруг Алтайских гор. На данном уровне представлены все исследуемые регионы России, Восточно-Казахстанская область Республики Казахстан, аймаки Увс, Баян-Улгий и Ховд Монголии и округ Алтай Синьцзянь-Уйгурского автономного района.</p> <p> </p> <p><strong>Индикаторы</strong></p> <p>База данных включает 68 показателей, сгруппированных в 10 структурных блоков: базовые индикаторы – 1 показатель; демография – 6 показателей; социальное благополучие населения – 5 показателей; социальная инфраструктура – 3 показателя; сельскохозяйственное землепользование – 16 показателей; продуктивность сельхозугодий и животных – 4 показателя; производство продукции сельского хозяйства – 8 показателей; региональная экономика – 3 показателя; индексы цен – 7 показателей; климат – 15 показателей.</p> <p>База данных представлена в виде книги Microsoft Excel с набором интерактивных таблиц, содержащим структурированные массивы данных, включающие статистики изменения индикаторов по десятилетиям и в целом за период.</p> <p>Каждый показатель был проанализирован на предмет наличия выбросов, неадекватных флуктуаций, наличия ступенек. Выбросы в данных проанализированы и скорректированы методами сглаживания. Краткосрочные пропуски (не более 5 лет) в данных были восстановлены методом линейной интерполяции, некоторые показатели в виду их отсутствия (преимущественно в аймаках Монголии) за ряд лет были оценены на основе эконометрических методов с использованием идентифицированных регрессионных зависимостей за определенный период времени с оценкой точности. Следует отметить, что современные процедуры обработки данных, практикуемые, например, FAO (FAOSTAT), также опираются на методы восстановления пропусков в данных по трендам или на основе эконометрических зависимостей между показателями. Данные имеют маркировку о наличии коррекции (1/0), где 1 – данные без корректировки, 0 – данные были с корректированы или восстановлены в виду наличия пропусков. Использование такой маркировки, позволяет фильтровать датасет в зависимости от решаемых задач.</p> <p>Разработанная база данных представляет уникальный массив данных и может быть использована для решения задач анализа динамики землепользования на различных этапах развития социально-экономических систем в постсоветский период, анализа роли климатических факторов в развитии региональных экономик Большого Алтая, моделирования последствий климатических изменений на аграрное производство, оценки степени интеграции региональных экономик в области сельскохозяйственного производства и др.</p> <p><strong>Доступ к базе данных возможен по согласованию с авторами.</strong></p> <p> </p> <p><strong>Благодарность. </strong>Работа выполнена при финансовой поддержке НИР «Алтайский вектор евразийской экономической интеграции: вызовы трансграничности, эффекты, стратегические задачи и приоритеты для Алтайского края» (FZMW-2023-0015).</p&gt

    Dataset_1

    No full text
    <p>This dataset is part of SEJ-601 research group. You may cite it as: Huerta-Álvarez, R.; Cambra-Fierro, J.J.; Fuentes-Blasco, M. (2020). “The interplay between social media communication, brand equity and brand engagement in tourist destinations: An analysis in an emerging economy”. Journal of Destination Marketing & Management, 16, pp. 100413. https://doi.org/10.1016/j.jdmm.2020.100413</p&gt

    Preguntas examen Manuel Rego 2004 -2008

    No full text
    Preguntas examen Manuel Rego 2004 -200

    RegVar annotation files

    No full text
    <p>Required annotation files for RegVar; must be in correct directory according to github, https://github.com/RomoL2/RegVar (for example, located in: /Library/Frameworks/R.framework/Versions/4.0/Resources/library//RegVar/inst/extdata).</p&gt

    51,964

    full texts

    3,594,064

    metadata records
    Updated in last 30 days.
    ZENODO is based in Switzerland
    Access Repository Dashboard
    Do you manage ZENODO? Access insider analytics, issue reports and manage access to outputs from your repository in the CORE Repository Dashboard!