Çukurova University Institutional Repository
Not a member yet
37292 research outputs found
Sort by
The Mediating Effect of Depression and Disability in the Relationship Between Schizophrenia and Self-Esteem
No full textDepressive symptoms, in addition to positive and negative symptoms, are commonly observed in the course of schizophrenia. These symptoms may cause disability and reduced self-esteem. Disability and lower self-esteem may disrupt the quality of life and lead to social isolation. Demonstrating the relationships among these concepts and correcting possible disturbances may help to augment treatment compliance and improve the prognosis. In this study, the Calgary Depression Scale for Schizophrenia (CDSS), the Positive and Negative Syndrome Scale for Schizophrenia (PANSS), the World Health Organization Disability Assessment Schedule 2.0 (WHODAS), and the Rosenberg Self Esteem Scale
(RSES) were applied along with a sociodemographic data form to 146 patients with schizophrenia. Path analyses were used to demonstrate the direct effect of schizophrenia severity on self-esteem and its indirect effect through disability and depression, the mediating effect of depression in the relationship between schizophrenia severity and disability,
and the mediator effect of disability in the bidirectional relationship between self-esteem and
depression. Statistically significant results were obtained. In multivariate regression analysis, significant effects on disability were demonstrated for PANSS General Psychopathology
subscale, CDSS, and RSES. These data suggest that attention should be focused on concepts
such as depression, disability, and self-esteem in schizophrenia patients
Electron transport properties of silicene: Intrinsic and dirty cases with screening effects
No full textThe electronic transport characteristics of silicene sheets are studied by an Ensemble Monte Carlo (EMC) technique in the presence of phonon (acoustic, non-polar optic, surface polar optic), surface roughness and ionized impurity scattering mechanisms. Both intrinsic and silicene on an Al2O3 substrate are considered. Screening is also considered for both ionized impurity and surface polar optic phonon scattering of electrons. The velocity-applied field characteristics are obtained for both cases. A negative differential resistance (NDR) behaviour is observed for intrinsic case only. The mobility of carriers are calculated as a function of temperature for both cases and the results are compatible with existing experimental results and theoretical predictions. The effects of screening and flexural phonons on mobility are also studied. © 2019 Elsevier B.V
Amerikan barışı mı Amerika dünyaya karşı mı? Soğuk Savaş sonrası Amerikan dış politikasının kapsamlı analizi.
No full textTEZ12647Tez (Yüksek Lisans) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 86-95) var.IX, 96 s. :_res. (bzs. rnk.), tablo ;_29 cm.Liberal Uluslararası Düzen’in geleceği, Uluslararası İlişkiler (Uİ) alanındaki en önemli gündem maddelerinden birisi konumundadır. Dünya, bir süredir, tarihteki en barışçıl ve müreffeh dönemlerden birisine tanıklık etmektedir. Ancak, Çin’in büyük bir güç olarak yükselişi ve sağ-popülist otoriter yönetimlerin dünyanın her yerinde görülmeye başlanması gibi faktörler, Uİ alanında çalışanları Liberal Uluslararası Düzen’in geleceğini sorgulamaya yöneltti. Bu tezde, Liberal Uluslararası Düzen’in karakteristik özellikleri, bu düzene yönelik tehditler ve düzenin geleceği gibi konular teorik düzlemde tartışılacaktır. Dahası, Amerika Birleşik Devletleri(ABD) en güçlü devlet olduğu için; ABD’nin sistemdeki rolü ve Soğuk Savaş sonrası ABD Dış Politikası, güç politikası üzerinden değerlendirilecektir. Ayrıca, Avrupa ve Asyalı müttefiklerine güvenlik sağlama gibi bazı geleneksel ABD politikaları, yapısal realizm perspektifinden ele alınacaktır. Dolayısıyla, bu tez çalışması bir bakıma Amerikan Dış Politikası ve Stratejisi çalışması olacaktır.The future of the liberal international order is one of the most discussed topics in International Relations (IR). The world has been witnessing one of the most peaceful and prosperous eras in any time in history. Yet, numerous factors such as China’s rise as a great power and rising right-wing populist authoritarianism around the globe have pushed scholars to question the future of the liberal international order. This thesis focuses on the characteristics of the liberal international order, threats against it and the future of world politics. Moreover, it analyzes role of the U.S. in the international system and American foreign policy after the Cold War through the point of power politics since the U.S. is the strongest state in the world. Traditional American foreign policy choices such as providing security to its European and Asian allies are examined within the framework of structural realism. This thesis argues that the liberal international order already collapsed and it predicts that great power politics will be the focal point of the new era
Hermeneutic reading on urban memory components: example of Adana Atatürk boulevard.
No full textTEZ12871Tez (Yüksek Lisans) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 151-161) var.XVII, 171 s. :_res. (bzs. rnk.), tablo ;_29 cm.20. yüzyıl modernleşme ve sanayileşme hareketleri açısından hızlı ve köklü değişimlerin yaşandığı bir dönemdir. Köyden kente yoğun nüfus göçünün yaşanması, ülke genelinde kente yerleşimlerin artmasına neden olmuştur. Bu durum; kentsel değişim ve dönüşüm hareketlerini başlatarak kent dokusunda bozulmalara, kimliksiz ve eskiden bağımsız bir yapılaşmaya yol açmış, kültürel mirasın korunması sorununu ortaya çıkarmıştır. Bu çalışmanın amacı, Adana'nın kent belleği değişimini, 1930-2018 yılları arasında Atatürk Caddesi'nde bulunan modern mimarlık ürünleri üzerinden okumaktır. Bu amaç doğrultusunda harita, çizim, fotoğraf arşivleri, anket tekniği ve SPSS analiz programı kullanılarak elde edilen veriler, mimarlık disiplini ile hermeneutik okuma yaklaşımı çerçevesinde kent okuması üzerinden ele alınmış ve kentsel bellek bileşenlerinin analizi sorgulanmıştır. Yapılan hermeneutik analizler sonucunda, Atatürk Caddesi'ndeki değişim etkisinin gözlem gruplarına göre farklılaştığı, yapısal müdahaleler ile iyi korunmuş ve tescilli yapıların kent belleğindeki yerini koruduğu, yakın dönemin nitelikli mimari ürünlerinin ise, yıkıma ve/veya tahribata uğradığı, kent belleğinden kaybolduğu, değerinin azaldığı ve korunması gerektiği tespit edilmiştir.The 20th century is a period of rapid and radical changes with modernization and industrialization movements. The intense population migration from the village to the city has led to an increase in urban settlements throughout the country.This situation; by initiating urban change and transformation movements, it caused disruptions in urban texture, an unidentified and formerly independent building, and raised the problem of preserving cultural heritage. The aim of this study is to read Adana's urban memory change over modern architectural products on Atatürk Boulevard between 1930-2018. For this purpose, the data obtained by using map, drawing, photograph archives, questionnaire technique and SPSS analysis program were handled through urban reading within the framework of architectural discipline and hermeneutic reading approach and the analysis of urban memory components was questioned. As a result of hermeneutical analysis, the effect of change on Atatürk Boulevard differs according to the observation groups, the well-preserved and registered buildings with structural interventions have preserved their place in the city's memory, while the architectural products of the recent period have been destroyed and / or destroyed, lost from urban memory, and their value has decreased. It has been determined that it should be protected
Self-healing of mild steel with polyacrylate materials.
No full textTEZ12950Tez (Yüksek Lisans) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 97-100) var.XXI, 101 s. :_res. (bzs. rnk.), tablo ;_29 cm.Yumuşak çelik (ST37) poliakrilat esaslı polimer malzeme ile kaplanmıştır. Polimer malzeme içerisine molibdat, miristik asit kimyasalları ilave edilerek Harrison çözeltisi (%0.35 (NH4)2SO4, 0.05 NaCl) ortamında korozyon testleri yapılmıştır. Bu testler yapılırken kullanılan kimyasalların derişimleri değiştirilerek alınan sonuçlar kaplama olmayan yüzey ile ve ilave edilen kimyasallarla karşılaştırılarak sonuçlar yorumlanmıştır. Elde edilen sonuçlara göre polimer içerisine ilave edilen kimyasallarla korozyon direncinin arttığı görülmüştür. Özellikle %5 ve %10 miristik asit ilave edilen yumuşak çelik yüzeylerinden olumlu sonuç alınmıştır. Ayrıca Poliakrilat kaplama, çelik malzeme yüzeyinde fiziksel bariyer olarak etkindir ve korozif ortamdaki agresif bileşenlerin metale ulaşmasını engellemektedir. Ancak zamanla su almasına bağlı olarak, bariyer özelliği zayıflamaktadır. Bu durumda, kaplamanın koruyuculuğu kalınlığı ile doğrudan orantılıdır. Ancak dışarıdan bir etkiyle yüzeyde çizik meydana geldiğinde, hasarlı bölge savunmasızdır. Boya ve kaplamalar için uluslararası kabul gören testlerde, kaplamanın çizik performansı esas alınmaktadır. Bu nedenle de poliakrilar kaplamaya miristik asit ve molibdat katkılanarak, çizik performansı üzerine etkileri incelenmiştir.It is coated with mild steel (ST37) polyacrylate polymer material. It contains corrosion tests from Harrison solution (%0.35 (NH4)2SO4, 0.05 NaCl). The concentrations of the chemicals used during these tests were compared with the uncoated surface and the added chemicals. According to the results obtained, it will be seen that the corrosion resistance increases with the chemicals added to the polymer. Choose positive results, especially from mild steel surfaces from where 5% and %10 myristic acid are added. In addition, the polyacrylate coating acts as a physical barrier on the surface of the steel material and prevents aggressive components in the corrosive environment from reaching the metal. However, due to the intake of water overtime, its barrier feature weakens. In this case, the protection of the coating is directly proportional to its thickness. However, when scratches occur on the surface with an external effect the damaged area is vulnerable. The internationally accepted tests for paints and coatings are based on the scratch performance of the coating. For this reason, myristic acid and molybdate are added to the polyacrylate coating and their effects on scratch performance are examined
Pharmacoeconomic modelling approach in surfactant usage and stock optimization.
No full textTEZ13186Tez (Doktora) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 83-88) var.XV, 95 s. :_29 cm.Yenidoğan bebeklerde surfaktan eksikliği sonucu gelişen akciğer yetersizlik tablosu hastalık ve ölümün önemli bir nedenidir. Tedavide acil ihtiyaç duyması ve yaşamsal fonksiyonların sürdürülmesi açısından surfaktanın, talep edildiğinde ulaşılabilir olması oldukça önemlidir. Hasta gelişleri arasındaki sürenin ve gelen hasta ağırlıklarının zamanla rastsal olarak değişmesi hastanede ihtiyaç duyulacak surfaktan miktarının belirlenmesini zor bir problem haline getirmektedir. Surfaktan tedavisinde hastaların ihtiyacı olan surfaktan dozu, hastanın ağırlığına göre hesaplanmaktadır. Bu çalışmada, bu rastgele değişkenler göz önünde bulundurularak optimum flakon sayısı bulunurken aynı zamanda surfaktanın satın alma, sipariş, elde bulundurma ve atık maliyetlerini minimum yapan matematiksel programlama modeli geliştirilmiştir. Maliyet ve talebin birbirini etkilediği bu farmakoekonomik modelle sürekli kontrol stok politikası altında her preperat ve her flakondan ne kadar satın alınması gerektiği, tekrar sipariş verme noktaları ve yıllık sipariş sayısı hesaplanmıştır. Ayrıca matematiksel modelle hastaneye gelen herbir hastaya verilmesi gereken optimum preperat çeşidi ve flakon büyüklüğü elde edilmiştir. Elde edilen optimum değerin geçerliliği 66 yataklı yenidoğan yoğun bakım ünitesi olan büyük bir hastanenin gerçek verileri kullanılarak bir simülasyon modeliyle test edilmiştir.Surfactant deficiency in newborns is a result of the respiratory insufficient condition which is a major cause of illness and death. In terms of the maintenance of vital functions that require emergency intervention, it is crucial that surfactant is available for treatment upon request. The unknown times between patient arrivals and the patient’s stochastic weight changes in the hospital cause difficulties in determining the amount of surfactant needed. The surfactant dosage needed for treatment of patients must be calculated according to the patient’s weight. In this study, the mathematical programming model that minimizes the purchase, order, holding and waste costs of the surfactant has been developed while finding the optimum vial by considering these random variables. The pharmacoeconomic model, with cost and demand affecting each other, uses a continuous inventory control policy, including calculating how much each preparation and vial should be buy for, the points for ordering it again, and the number of orders. Also, the validity of the optimum values obtained with the mathematical model of the 66 bed neonatal intensive care unit in a hospital was tested with real data and a simulation model
Characterization of cucumber mosaic virus (CMV) in tomato areas of Adana and Mersin provinces.
No full textTEZ12883Tez (Yüksek Lisans) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 57-68) var.XIII, 74 s. :_res. (bzs. rnk.), tablo ;_29 cm.Bu çalışma, 2017-2019 yılları arasında ilkbahar ve yaz dönemlerinde Adana ve Mersin illerinde domates üretim arazilerinde Hıyar mozaik virüsü (Cucumber mosaic virus, CMV)’nün saptanması ve karakterizasyonu amacıyla yürütülmüştür. Domates alanlarında simptomatolojik olarak CMV ile enfekteli olduğundan şüphelenilen toplam 150 adet domates bitkisinden yaprak ve meyve örnekleri alınmış ve DAS-ELISA testleri sonucunda 29 bitkide CMV infeksiyonu saptanmıştır. RT-PCR çalışmaları, CMV’ye spesifik RW8 (5'-GGTTCGAA (AG)(AG)(AT)ATAACCGGG–3') ve RV11 (5'-GTTTATTTACAAGAGCGTAC GG–3') dejenere primer çifti kullanılarak, DAS-ELISA da pozitif olarak saptanan 29 örnek içerisinden 9 izolat ile yürütülmüş ve 650 bp büyüklüğünde bant elde edilmiştir. Bunlar içinden survey alanlarını temsil edecek şekilde CMV-12 (Tuzla K12), CMV-17 (Ceyhan C25) ve CMV-21 (Erdemli E29) olmak üzere 3 izolat seçilmiş ve DNA dizileme çalışmalarında kullanılmıştır. Dizi analizleri sonucunda, dünyanın farklı ülkelerinden rapor edilen CMV izolatları kullanılarak oluşturulan filogenetik ağaç üzerinde CMV-12 ve CMV-21 izolatları aynı grupta yer alırken, CMV-17 izolatı farklı bir gruba dahil olmuştur.This study was carried out to detect and characterize Cucumber mosaic virus (CMV) in tomato production areas in Adana and Mersin provinces in the spring and summer periods between 2017-2019. Leaf and fruit samples were collected from a total of 150 tomato plants suspected to be infected with CMV symptomatologically in tomato fields and as a result of DAS-ELISA tests. CMV infection was detected in 29 plants. RT-PCR studies were carried out with 9 isolates out of 29 specimens positive in DAS-ELISA using a CMV specific RW8 (5'-GGTTCGAA(AG)(AG)(AT)ATAACCGGG–3') and RV11 (5'- GTTTATTTACAAGAGCGTAC GG–3') degenerate primer pair and a band size of 650 bp was obtained. Among these, 3 isolates were selected as CMV-12 (Tuzla K12), CMV-17 (Ceyhan C25) and CMV-21 (Erdemli E29) to represent the survey areas and were used in DNA sequencing studies. As a result of sequence analysis, CMV-12 and CMV-21 isolates are in the same group on the phylogenetic tree created using CMV isolates reported from different countries of the world, while CMV-17 isolate is included in a different group.Bu Çalışma Ç.Ü. Bilimsel Araştırma Projeleri Birimi Tarafından Desteklenmiştir. Proje no: FYL-2018-7227
An investigation of the relationship between high school students’ image of God and their value orientation: the example of Yalova.
No full textTEZ13161Tez (Doktora) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 99-119) var.XV, 127 s. :_res. (bzs. rnk.), tablo ;_29 cm.İnsanın yaşam serüvenine başlaması ile birlikte, aşkın bir varlığa (Tanrı'ya) inanma ihtiyacı onunla beraber zuhur etmiştir. Her ne kadar yaşam döngüsü içerisinde, aşkın varlığın adı değişiklik gösterse de insan için yeri ve ehemmiyeti hiç değişmemiştir. Son zamanlarda birçok bilim insanı ve araştırmacı tarafından, Tanrı tasavvuru ile değerlerin insan yaşantısı ve davranışlarına etkisi daha yoğun bir şekilde araştırılmaktadır. Buradan yola çıkarak; çalışmamızın temel amacı, Yalova örneği üzerinden, lise öğrenimi gören öğrencilerin Tanrı algısı ve değer eğilimlerini ortaya koymak, Tanrı tasavvuru-değer yönelimleri ile demografik değişkenler arasındaki ilişkileri incelemektir. Çalışmamızda ilişkisel tarama yöntemi kullanılmıştır. Araştırmada 494 kişilik örneklem grubuna Tanrı Algısı ölçeği ile Schwartz Değer ölçeği uygulanmıştır. Veri analiz çözümlerinde korelasyon, t-testi ve çoklu doğrusal regresyon kullanılmıştır. Çalışmamız; Tanrı algısı ve değer yönelimleri adı altında, iki başlık üzerine kurulmuştur. Araştırma sonuçlarına göre İmam Hatip Lisesi öğrencilerinin Tanrı algısı (genel Tanrı algısı ile sevgi ve merhamet yönelimli Tanrı algısı); Anadolu Lisesi öğrencilerinin Tanrı algısından daha yüksektir. Anne-baba eğitim düzeyi düştükçe; öğrencilerin, genel tanrı algısı ile sevgi ve merhamet yönelimli Tanrı algıları artmaktadır. Değer yönelimlerinde, erkeklerin en çok önemsediği değer hazcılık; kızların ise özyönelim, evrenselcilik, iyilikseverlik ve güvenlik değerleridir. Hazcılık değeri; Anadolu Lisesi öğrencilerinde, İmam Hatip Lisesi öğrencilerine göre daha yüksektir. Güç, başarı, geleneksellik, uyma/itaat, güvenlik ve dindarlık değerleri İmam Hatip Lisesi öğrencilerinde, Anadolu Lisesi öğrencilerine göre daha yüksektir. Anne eğitim düzeyi arttıkça, dindarlık değer eğilimi azalmaktadır. Baba eğitim düzeyi arttıkça; dindarlık, geleneksellik, uyum/itaat yönelimleri azalmaktadır. Tanrı algısı ve değer ilişkisine bakıldığında; öğrencilerin genel Tanrı algısı arttıkça; güç, başarı, evrenselcilik, iyilikseverlik, geleneksellik, uyum/itaat, güvenlik ve dindarlık eğilimleri artmakta; hazcılık değeri azalmaktadır. Sevgi ve merhamet yönelimli Tanrı algısı arttıkça; güç, başarı, evrenselcilik, iyilikseverlik, geleneksellik, uyum/itaat, güvenlik, dindarlık ve uyarılım eğilimleri artmaktadır. Korku ve ceza yönelimli Tanrı algısı arttıkça; güç, hazcılık, uyarılım, dindarlık ve güvenlik değerleri azalmaktadır. Sonuçlar, Tanrı algısı, değer yönelimleri ve Tanrı algısı değer ilişkisi konusunda alanyazında yapılmış çalışmaların bulgularıyla karşılaştırmalı olarak tartışılmıştır.At the very dawn of humankind’s adventure there arose a need to believe in a transcendent being (i.e.in God). The name of that transcendent entity may have changed along the way, but its importance and its status for humankind has never changed. Recently the influence exerted on human life and behaviour by the image of God and associated values has been investigated more intensively by a number of scientists and researchers. Taking this as the starting point, the main aim of the present study was touse the example of Yalova to present high school students’ image of God and their value biases, and to examine how their image of God and their value orientation related to demographic variables. Relational screening method was used in our study, and applied the Image of God scale and the Schwartz Value Scale to a sample group of 494 subjects. Correlation, t-test and multiple regression were used to analyse the data. This study focussed on two main headings: image of God, and value orientations. The results of the research indicated that Imam Hatip School students’ image of God (general image of God, and love and compassion-oriented image of God) was higher than that of Anatolian High School students. The lower the level of education of the parents, the higher was the students’ general image of God, and their love and compassion-oriented image of God. With regard to their value orientations, the value to which males attached most importance was hedonism, while for the females it was values of self-direction, universalism, benevolence and security. The hedonism value was higher in the Anatolian High School students than in the Imam Hatip High School students. The values of strength, achievement, traditionalism, compliance/obedience, security and devoutness were higher in Imam Hatip High School students than in Anatolian High School students. The higher the mother’s level of education, the lower the value bias for devoutness. The higher the father’s level of education, the lower the orientations for devoutness, traditionalism and compliance/obedience. Looking at the relationship between image of God and values, the greater the students’ general image of God, the greater the orientation for strength, achievement, universalism, benevolence, traditionalism, compliance/obedience, security and devoutness, but the lower the hedonism value. The greater the love and compassion-oriented image of God, the higher the orientations for strength, achievement, universalism, benevolence, traditionalism, compliance/obedience, security, devoutness, and stimulation. Where the fear and punishment-oriented image of God was greater, the values for strength, hedonism and security were lower. The results were discussed and compared with the findings of other studies in the literature on the image of God, value orientations, and the relationship between image of God and values
The association of preschool children’s mental representation in the relationship with their parents, Teachers and friends with school adjustment.
No full textTEZ12964Tez (Doktora) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 128-163) var.XV, 178 s. :_res. (bzs. rnk.), tablo ;_29 cm.Okul öncesi dönemde çocukların okula karşı tutumları ve okulda yaşadıkları deneyimler, gelecekteki sosyal ve akademik başarıları için temel oluşturmaktadır. Çocukların ebeveynleriyle, öğretmenleriyle ve arkadaşlarıyla kurdukları ilişkilerin niteliği onların tüm okul deneyimlerini etkileme potansiyeline sahiptir. Bu araştırmada ebeveyn-çocuk bağlanması, öğretmen-çocuk ilişkileri ve arkadaşlık ilişkilerinde çocukların sahip oldukları zihinsel temsillerinin okula uyum üzerindeki etkisini ekolojik ve bağlanma kuramları temelinde incelemek ve sistemler kuramı çerçevesine dayanan yapısal bir model ile test etmek amaçlanmıştır. İlişkisel tarama modeli olarak planlanan araştırmada, gözlenen ve gizil değişkenler arasındaki ilişkileri modellemek amacıyla yapısal eşitlik modellemesi (YEM) kullanılmıştır. Araştırmaya Osmaniye il merkezinde okul öncesi eğitim kurumlarına devam eden ve uygun örnekleme yöntemi ile belirlenmiş 91 çocuk katılmıştır. Çocukların yaşları 60-72 ay arasında değişmektedir. Araştırmada, çocukların yakın çevresindeki yetişkinler ve arkadaşlarıyla ilişkileri öykü tamamlama prosedürü kullanılarak değerlendirilmiştir. Tüm veriler, çocuklarla yapılan yüz yüze görüşmeler yoluyla elde edilmiştir. Ebeveyn-çocuk bağlanmasını değerlendirmek amacıyla Bağlanma Öykü Tamamlama Testi ve bu testin daha sistematik ve ayrıntılı bir değerlendirmesini sağlamak amacıyla Q–Sıralama kodlama prosedürü kullanılmıştır. Çocuklar ayrıca Öğretmen-Çocuk İlişkileri Öykü Tamamlama Testi, Arkadaşlık İlişkileri Öykü Tamamlama Testi ve Türkçe Erken Dil Gelişim Testi’ni tamamlamışlardır. Çocukların okula uyumları ise çocukların algılarına dayalı Okulu Sevme ve Okuldan Kaçınma Ölçeği aracılığıyla belirlenmiştir. Araştırmanın verileri 17 Eylül 2018 – 21 Aralık 2018 tarihleri arasında araştırmacı tarafından çocuklarla yapılan görüşmeler aracılığıyla toplanmıştır. Dört farklı oturumda planlanan araştırmada toplam 364 oturum gerçekleştirilmiştir. Ebeveyn, öğretmen ve arkadaşlık ilişkilerinin niteliğini değerlendirmek amacıyla, çocuklarla görüşmelerden elde edilen ve kamera ile kayıt altına alınan veriler araştırmacı ve araştırmacı dışındaki kodlayıcılar tarafından kodlanmıştır. Araştırmanın tüm verileri bilgisayar ortamına aktarılmış ve YEM analizinin varsayımları test edilmiştir. Ebeveyn çocuk bağlanma boyutlarından güvenli ve kaygılı bağlanma yüksek derecede korelasyon gösterdiğinden kaygılı bağlanma analizlere dahil edilmemiştir. Aynı zamanda kaçınan bağlanmanın okula uyumun anlamlı yordayıcısı olmadığı belirlenmiş ve bu nedenle kaçınan bağlanma da analizlere alınmamıştır. Bu işlemlerin ardından araştırmanın hipotezleri doğrultusunda oluşturulan modellerin uyum indeksleri incelenmiş ve verilerin modellerle iyi uyum gösterdikleri belirlenmiştir. Geliştirilen modeller güvenli ebeveyn-çocuk bağlanması, öğretmen-çocuk ilişkileri ve arkadaşlık ilişkileri niteliğinin okula uyum üzerinde önemli etkileri olduğunu göstermektedir. Güvenli ebeveyn-çocuk bağlanması, hem öğretmen-çocuk ilişkileri hem de arkadaşlık ilişkileri niteliğini etkilemektedir. Benzer şekilde öğretmen-çocuk ilişkileri niteliğinin, arkadaşlık ilişkileri niteliği üzerinde önemli etkileri olduğu belirlenmiştir. Ayrıca ebeveynle bağlanma, öğretmen-çocuk ilişkileri ve arkadaşlık ilişkileri niteliği düzeylerine dolaylı etkileri aracılığıyla da çocukların okula uyumunu etkilemektedir. Bulgular ilgili literatür dikkate alınarak ekolojik model, bağlanma ve sistemler kuramı çerçevesinde tartışılmıştır.Children's attitudes towards school and their experiences at school form the basis for their future social and academic success. The quality of the relationships that children establish with their parents, teachers, and friends has the potential to affect their entire school experience. In this study, it was aimed to examine the effects of parent-child attachment, teacher-child relations and friendship relations on school adjustment based on ecological and attachment theories and to test a structural model based on system theory framework. In the research planned as a relational screening model, structural equation modeling (SEM) was used to model the relationships between observed and latent variables. 91 children attending pre-primary education institutions in the city center of Osmaniye participated in the study. Children's ages ranged from 60-72 months. In the study, the relationship of children with adults and their friends was evaluated using the story completion procedure. Attachment Story Completion Task was used to evaluate parent-child attachment, and Attachment Story Completion Task Q-Sort was used to provide a more systematic and detailed assessment of this test. The children also completed the Teacher-Child Relationship Story Completion Task, Preschool Friendship Story Completion Task. The school adjustment of the children was determined by The School Liking and Avoidance Questionnaire based on the perceptions of the children. The data of the research were collected between September 17, 2018, and December 21, 2019, through interviews with children by the researcher. In the research planned in four different sessions, a total of 364 sessions were held. To evaluate the quality of parent, teacher and friendship relations, the data obtained from interviews with children and recorded by the camera were coded by the researcher and second coders. All the data of the research was transferred to the computer and assumptions of the SEM analysis were tested. Deactivation attachment from parent-child attachment dimensions was not included in the analysis because security and deactivation attachment showed a high correlation. At the same time, hyperactivation attachment dimensions were not determined to be a significant predictor of school adjustment and therefore hyperactivation attachment was not included in the analysis. After these procedures, the fit indices of the models whose hypotheses were created were examined and it was determined that the data fit well with the models. The developed models show that security parent-child attachment, teacher-child relationships, and friendship quality have important effects on school adjustment. security parent-child attachment affects both teacher-child relationships and the quality of friendship. Similarly, it was determined that teacher-child relationships had important effects on the quality of friendship. Additionally, results indicated that security parent-child attachment affected school adjustment through the indirect effect of teacher-child relationships and friendship quality. Findings are discussed within the framework of ecological model, attachment and system theory, considering the relevant literature
Mimarlık alanına özgü kelimelerin kelime kökü yöntemi ile yüksek öğretim düzeyinde öğretiminin etkileri.
No full textTEZ12971Tez (Yüksek Lisans) -- Çukurova Üniversitesi, Adana, 2020.Kaynakça (s. 57-63) var.XIV, 80 s. :_29 cm.Kelime öğrenme süreci, dil öğrenmenin en zor ve zaman alıcı tarafı olarak görülmektedir. Öğrenciler için Özel Amaçlı İngilizce (ÖAİ) kelimelerinin öğrenimini zorlaştıran faktörlerden biri de ÖAİ’de kullanılan kelimelerin sadece belli bir disiplin alana özgü olması ve genel İngilizcede nadiren kullanılmasıdır. Özel amaçlı İngilizce öğrenenlerin kelime ezberleme ve akılda tutma amacıyla kullandıkları farklı öğrenme stratejileri mevcuttur. Kelimeleri kök ve eklerine ayırmak bu stratejiler arasında olsa da, bu yöntem ÖAİ’de yeterli ilgiyi görmemiştir. Ayırca, kelime köklerinin öğretiminin faydaları üzerinde duran az sayıda çalışma vardır.Az sayıdaki bu çalışmalar, köklerle kelime öğrenmenin/öğretmenin verimliliğinin vurgulamaktadır. Ancak, bu stratejinin, ÖAİ kelimelerinin öğretimi ve bilinmeyen kelimelerin anlamına dair tahmin yürütme yeteneğine etkisi üzerinde durulmamıştır. Bu çalışmanın amacı, kelime kökleri eğitiminin bilinmeyen Özel Amaçlı İngilizce (ÖAİ) kelimelerinin anlamını doğru tahmin etmedeki ve öğrenilen kelimelerin kalıcılığındaki etkisini göstermektir. Bu çalışmadac deneysel yaklaşım benimsenmiştir. Aynı bölümde okuyan devlet üniversitesi öğrencilerinden her grupta otuz öğrenci olmak üzere iki farklı grup seçilmiştir. Çalışmanın başında, kontrol ve deney grubana kelime bilgilerini ölçmek ve grupların homojenliğini görmek için bir ön test uygulanmıştır. Hangi kelimelerin ÖAİ’ye ait olduğuna karar vermenin zor olması yüzünden, bu çalışmada kullanılan bütün testlerdeki kelimeler, 505.649 kelimelik mimarlık alanına özgü bir korpustan seçilmiştir. Ön testten sonra, hedef kelimeler deneysel gruba kelime kökleri yoluyla öğretilirken, kontrol gruba sadece sözlük kullanımı yoluyla öğretilmiş ve on hafta sonra bu yöntemin akılda kalıcılığa etkisini görmek için başka bir test uygulanmıştır. Bir hafta sonrasında ise öğrencilerin bilmedikleri ÖAİ kelimelerinin anlamını doğru tahmin etmedeki etkisini ölçmek için bir test daha uygulanmıştır. Üçgenleme amacıyla, uygulanan testlerin yanı sıra öğrencilerden günlük tutmaları da istenmiş ve ayrıca öğrencilerle görüşme de yapılmıştır. Yapılan testlerin sonuçları SPSS 23 ile analiz edilmiş ve nitel verilerin değerlendirilmesi için ise tematik analiz yöntemi kullanılmıştır. Yapılan testlerin sonuçları ve katılımcıların görüşmelerde sorulan sorulara verdikleri cevaplar ve günlüklerinde bu metot hakkında yazdıkları görüşleri, kelime kökü metodunun İngilizce kelimelerini öğrenmede etkili bir yöntem olduğunu göstermektedir.The vocabulary learning process is seen as difficult and time consuming part of language learning. One of the factors that makes it difficult for students to learn English for specific purpose (ESP) words is that the words used in ESP are specific to a particular discipline and rarely used in general English. There are different learning strategies used by ESP learners for memorizing and retention of words. Although dissecting words into their roots and suffixes is among these strategies, it has not received enough attention in ESP vocabulary teaching. There are also few studies focusing on the benefits of teaching vocabulary roots. These few studies underline the efficiency of vocabulary learning/teaching with roots. However, the impact of the word root strategy on the teaching of ESP words and its ability to predict the meaning of unknown words has not been emphasized. The aim of this study is to show the effect of the word roots training on predicting the meaning of unknown ESP words correctly and the retention of these words. The experimental approach was adopted throughout the study. Two groups of students studying in the same department of a state university participated in the present study. Each group was composed of 30 students. A pre-test was applied to both control and experimental groups at the beginning of the study to see the word knowledge the homogeneity of the groups. As it is hard to decide which words are ESP words, the words in all tests applied in this study were selected from a corpus of 505,649 words related to Architecture. After the pre-test, the words were taught to the treatment group through word root training while the control group learnt these words through dictionary usage. Ten weeks later, a post-test was performed to observe the effect of this method on vocabulary retention. A week later, a delayed post-test was also conducted to measure the students’ competence of predicting the meaning of the ESP words they had never seen before. For triangulation, in addition to pre-test, post-test and delayed post-test, students were asked to keep a diary and they were also interviewed. The tests’ scores were analyzed via SPSS 23 and thematic analysis was used for the analysis of the qualitative data. The results of the tests applied, the answers of the participants given in the interviews and the extracts from the diaries the participants kept all showed that word root strategy is an effective and welcomed tool for learning new English words