Exeley Inc.

Reiner, Alexander P.

Teramura, Gayle

A modified PCR-RFLP genotyping method demonstrates the presence of the HPA-4b platelet alloantigen in a North American Indian population

Wodzinski, M.A.

Collin, R.C.

Booker, D.J.

Stamps, R.

Bellamy, J.D.

Sokol, R.J.

Delayed hemolytic transfusion reaction and paroxysmal cold hemoglobinuria: an unusual association

Mosley, Jr., Archiaus L.

Trich, Mary Beth

Thomas, Nanette C.

Sandler, S. Gerald

Case report: reporting anti-G as anti-C+D may have misleading clinical implications

Julius, Carmen J.

Wade, Mindy

Waheed, Abdul

McNeil, Donald L.

Kennedy, Melanie S.

Common variable immunodeficiency: diagnosis by absent ABO reverse type

Alder, Brenda C.

Summers, Stephanie H.

Hare, Virginia

Comparison of hemagglutination and solid phase titration methods for determination of critical prenatal antibody titers

Hunter, Celeste J.

Ziebol, Michael D.

Anti-Jk3 with no clinical evidence of HDN

Levene, Cyril

Letters to the Editors: &quot;Those Were the Days&quot;

Quillen, Karen

Caron, James

Murphy, Kate

IMMUNOHEMATOLOGY, Volume 28, Number 4, 2012 137
Performance characteristics of two automated 
solid-phase red cell adherence systems for 
pretransfusion antibody screening:  
a cautionary tale
K. Quillen, J. Caron, and K. Murphy
RepoRt
Our institution has implemented two instruments, the Galileo and 
the Echo, that use different solid-phase red cell adherence assays 
for antibody screening in pretransfusion compatibility testing. 
During the initial implementation of these two instruments, we 
noticed very different problems: falsely positive results on the 
Galileo, and falsely negative results and lack of reproducibility 
on the Echo. Comparison of falsely positive antibody screen 
results from approximately equivalent numbers of samples run 
on the Galileo and samples tested by standard manual tube 
technique using low-ionic-strength saline enhancement showed 
a false-positive rate of 1.4 percent on the Galileo (defined as a 
positive screen with a negative panel). Testing using the Echo 
identified four cases of falsely negative antibody screens, (defined 
as a negative screen on a patient sample subsequently shown to 
be positive by the same method). In addition, we note a lack of 
reproducibility on the Echo, which emphasizes the importance 
of replicate testing during validation of automated antibody 
screening platforms. Immunohematology 2012;28:137–9.
Key Words: antibody screen, automated solid phase, 
specificity, reproducibility
Our institution was one of the early adopters of blood bank 
automation. In 2005, we implemented a large throughput, 
walkaway instrument (Galileo, Immucor, Norcross, GA), 
which uses a solid-phase red cell adherence (SPRCA) assay 
for antibody screening. Before that, we used manual tube 
method with low-ionic-strength saline (LISS) enhancement 
for routine pretransfusion antibody screening, reserving ficin 
and polyethylene glycol (PEG) for individualized workups. We 
continue to use tube testing with LISS for stat samples and 
during low-volume shifts.
The Galileo instrument offers walkaway automation with 
random access capability. In our validation testing, it was 
more sensitive than LISS, consistent with other reports. More 
recently, we added a second SPRCA assay instrument (Echo, 
Immucor), after an abbreviated validation that demonstrated 
100 percent concordance between Echo and Galileo results 
on almost 150 specimens. During the initial implementation 
of these two instruments, we noticed very different problems: 
falsely positive results on the Galileo, and falsely negative 
results and lack of reproducibility on the Echo. These issues 
form the basis of this report.
Materials and Methods
Galileo Testing
For a 7-week phase-in period in 2006, samples for antibody 
screening (ABSC) were tested by manual tube method with 
LISS (tube, three-cell screen) or on the Galileo (two-cell screen), 
depending on the urgency of the transfusion or availability of 
a trained operator. Positive ABSC results on the Galileo were 
investigated with a panel on the instrument. Inconclusive 
Galileo panels, defined as those in which no antibody specificity 
was identified, were followed by a manual PEG panel. The 
Galileo ABSC result is considered falsely positive if the Galileo 
panel is negative or if the PEG panel is negative. Positive LISS 
ABSC results were followed up with LISS panels.
Echo Testing
Within the first few months of implementation of the Echo, 
in 2011, using the latest software (v 1.2.2) and a three-cell 
screen (Capture-R Ready-Screen [3], Immucor), we noticed 
four cases of negative antibody screens in patients known to 
have positive screens on recent prior specimens. Manual visual 
review of these negative results was equivocal. We noticed 
that one of the index samples was interpreted as equivocal on 
one run, which was manually interpreted as negative, then 
3+ on a subsequent run of the same instrument using the 
same lot of reagents. We selected 29 additional samples with 
positive antibody screens (by Galileo testing), and reran each 
specimen multiple times on the Echo. The replicate testing 
was performed with the same reagent lot, typically within the 
same day. These samples were all less than 14 days old, and 
had been stored at 1° to 4°C, in accordance with the storage 
specifications of all patient samples at our institution.
138 IMMUNOHEMATOLOGY, Volume 28, Number 4, 2012
Results
Galileo Testing
A total of 3297 ABSCs were performed, of which 1362 
were done with Galileo testing. Of the 1362 Galileo ABSCs, 
67 (4.9%) were positive. In 13 cases, LISS panels had been 
completed within the prior 7 days or the specimen was not 
sufficient in quantity for further evaluation. Evaluating the 
remaining 54 positive ABSCs on the Galileo, 35 (64.8%) were 
true positives and 19 (35.2%) were false positives (Table 1). 
Of the 19 falsely positive Galileo ABSCs (19/1349 = 1.4% 
false-positive rate), 14 had negative Galileo panels and 5 had 
inconclusive Galileo panels (the latter 5 cases had negative 
PEG panels). Of the 1935 manual ABSCs, 27 LISS panels 
were performed of which 100 percent were true positives. We 
did not observe any patient-specific factors such as pregnancy 
or medications common to the falsely positive Galileo results, 
but the reaction values typically were low, just above the 
numeric cutoff threshold. These falsely positive Galileo ABSC 
results were reproducible on repeat automated testing (data 
not shown).
Echo Testing
During the period of live testing, 4 missed positive 
antibody screens were discovered in a total of 3838 tests 
performed (4/3838 = 0.1%). These samples tested negative 
on initial Echo ABSC, but raised suspicion because of records 
showing recent prior positive ABSCs. They are listed in 
Table 2. Only 1 patient had received any red blood cell (RBC) 
transfusions between tests (the second patient, who is a 
chronically transfused sickle cell patient). The true incidence 
of missing a positive antibody screen is likely much higher, 
in cases when the patient does not have any recent positive 
ABSC result for comparison.
Of the 29 samples with known positive antibody screens 
on the Galileo selected for replicate testing, 5 were discovered 
to have inconsistent results. These are detailed in Table 
3. The reaction strengths varied from 3+ to negative on a 
representative sample with anti-Fya.
Discussion
The goal of pretransfusion compatibility testing is to 
optimize the detection of clinically significant RBC antibodies 
in a timely and cost-effective algorithm. Automated SPRCA 
platforms have been extensively used in antibody screening 
of blood donors, a population in which the prevalence of 
alloimmunization is expected to be low. PEG is generally 
considered to be the most sensitive method for tube indirect 
antiglobulin testing.1 Manual SPRCA was found to rival PEG 
in sensitivity and specificity; automated SPRCA on an earlier 
instrument (ABS2000, Immucor) had a lower sensitivity than 
PEG and manual SPRCA but better specificity.2,3 We found that 
one third of positive ABSC results on Galileo may be falsely 
positive, with no identifiable specificity on Galileo or PEG panel 
testing.4 In our anecdotal experience during the past 6 years, 
falsely positive Galileo ABSC results have recurred in the same 
patient on subsequent samples over time and have not been 
associated with the subsequent detection of true alloantibodies. 
K. Quillen et al.
Table 1. Positive antibody screen results on Galileo and using 
tube low-ionic-strength saline method
Number of samples Galileo Tube LISS Total
ABSC 1362 1935 3297
Positive ABSC 67 (4.9%) 27 (1.4%) 94 (2.9%)
Panels completed 54 27
True positive 35 27
False positive 19 0
ABSC = antibody screen; LISS = low-ionic-strength saline.
Table 2. Falsely negative antibody screen results on Echo
Known antibody 
specificities
Number of days 
from last positive 
screen
Result on prior 
ABSC (test 
method)
Result of repeat 
ABSC testing on 
Echo
Echo panel 
result (reaction 
strength)
E 2 2+ (Galileo) 3+  anti-E (3+)
E 60 2+ (Galileo) 2+  anti-E (2+)
E 4 2+ (Echo)* 2+  anti-E (3+)
K 19 1+ (Galileo) 3+  anti-K (3+)
ABSC = antibody screen
*Same reagent lot
Table 3. Inconsistent antibody screen results on replicates of 
known positive specimens tested on the Echo
Antibody 
specificity
Number of  
replicates
Sequential results  
(number of replicates)
Antigen dosage on 
implicated cell
Fya 2 3+, ? Single dose
E, K, M 10 3+(×4), ?(×3),  
1+(×2), 2+
Double dose
Jka* 11 3+(×9), ?, 3+ Double dose
Fya 11 3+, 1+, ?(×2),  
2+, neg(×6)
Single dose
Jka* 11 3+(×8), ?(×2), 3+ Double dose
*Same patient, 2 different specimens.
? indicates an equivocal result reported on the instrument.
IMMUNOHEMATOLOGY, Volume 28, Number 4, 2012 139
Automated solid-phase antibody screening
They have not been detected at all in populations at high risk 
of alloimmunization such as chronically transfused sickle cell 
patients.
Falsely negative antibody screen results are of greater 
clinical concern; they have been reported with the Echo 
and attributed to a defective image analysis algorithm.5 The 
incidence of falsely negative antibody screens depends on how 
cases are identified and the prevalence of alloimmunization 
in the population studied. It varies from 0.02 percent in a 
single-institution retrospective study6 to 0.5 percent based on 
proficiency testing results in the United Kingdom.7
The lack of reproducibility on the Echo that we discovered 
has not been previously reported. Preanalytic factors such 
as lipemia and hemolysis were not implicated in the cases, 
and depletion of sample volume is unlikely because weaker 
(or even negative) results occurred in the middle of a 
sequence of replicates, rather than being skewed during the 
last run. Automation is a relatively recent innovation in the 
immunohematology testing arena compared with other areas 
of clinical laboratory testing, and the importance of replicate 
testing may not be widely appreciated. We submit this 
report as a cautionary tale that automated blood bank solid-
phase platforms from the same manufacturer may have very 
different performance characteristics and to emphasize the 
importance of replicate testing during validation. Heightened 
alertness during the initial implementation of a new test 
method is required to correlate current results with patients’ 
prior antibody screen results, despite the well-known problem 
of antibody evanescence.8
References
 1. Nance SJ, Garratty G. A new potentiator of red blood cell 
antigen-antibody reactions. Am J Clin Pathol 1987;87:633–5.
 2. Bunker ML, Thomas CL, Geyer SJ. Optimizing pretransfusion 
antibody detection and identification: a parallel, blinded 
comparison of tube PEG, solid-phase, and automated methods. 
Transfusion 2001;41:621–6.
 3. Yamada C, Serrano-Rahman L, Vasovic LV, Mohandas K, 
Uehlinger J. Antibody identification using both automated 
solid-phase red cell adherence assay and a tube polyethylene 
glycol antiglobulin method. Transfusion 2008;48:1693–8.
 4. Xu H, Murphy K, Caron J, Quillen K. False positive results in 
automated solid-phase RBC antibody screening in a transfusion 
service (abstract). Transfusion 2006; 46(9 Suppl):147A.
 5. Kang SH, Gloster E, White M, Swiderski I, Bradley L. False-
negative reactions due to incorrect image analysis by automated 
solid-phase red blood cell adherence assay. Transfusion 
2010;50:2282–3.
 6. Powers A, Chandrasheka S, Mohammed M, Uhl L. Identification 
and evaluation of false-negative antibody screens. Transfusion 
2010;50:617–21.
 7. Knowles SM, Milkins CE, Chapman JF, Scott M. The United 
Kingdom National External Quality Assessment Scheme 
(Blood Transfusion Laboratory Practice): trends in proficiency 
and practice between 1985 and 2000. Transfus Med 
2002;12:11–23.
 8. Tormey CA, Stack G. The persistence and evanescence of blood 
group alloantibodies in men. Transfusion 2009;49:505–12.
Karen Quillen, MD, MPH (corresponding author), Medical Director, 
James Caron, MT (ASCP), Assistant Supervisor, and Kate Murphy, 
MT (ASCP), SBB, Technical Supervisor, Blood Bank, Boston Medical 
Center Department of Pathology and Laboratory Medicine, 88 East 
Newton Street, H-4900, Boston, MA 02118.
Important Notice About Manuscripts for 
Immunohematology
Please e-mail all manuscripts to immuno@redcross.org
Attention: SBB and BB Students
You are eligible for a free 1-year subscription to 
Immunohematology.
Ask your education supervisor to submit the name and 
complete address for each student and the inclusive dates 
of the training period to immuno@redcross.org


Performance characteristics of two automated solid-phase red cell adherence systems for pretransfusion antibody screening:&nbsp; a cautionary tale

Erratum Vol. 26, No. 4, 2010, p. 164

Tuson, Michelle

Hue-Roye, Kim

Koval, Karen

Imlay, Sherwin

Desai, Rajendra

Garg, Gayatri

Kazem, Esam

Stockman, Diane

Hamilton, Janis S.

Reid, Marion E.

58 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011
Antibodies to antigens in the Kell blood group system are usually 
immunoglobulin G, and, notoriously, anti-K, anti-k, and anti-Kpa 
can cause severe hemolytic transfusion reactions, as well as severe 
hemolytic disease of the fetus and newborn (HDFN). It has been 
shown that the titer of anti-K does not correlate with the severity 
of HDFN because, in addition to immune destruction of red 
blood cells (RBCs), anti-K causes suppression of erythropoiesis 
in the fetus, which can result in severe anemia. We report a case 
involving anti-Kpa in which one twin was anemic and the other 
was not. Standard hemagglutination and polymerase chain 
reaction (PCR)-based tests were used. At delivery, anti-Kpa was 
identified in serum from the mother and twin A, and in the eluate 
prepared from the baby’s RBCs. PCR-based assays showed twin 
A (boy) was KEL*841T/C (KEL*03/KEL*04), which is predicted 
to encode Kp(a+b+). Twin B (girl) was KEL*841C/C (KEL*04/
KEL*04), which is predicted to encode Kp(a–b+). We describe 
the first reported case of probable suppression of erythropoiesis 
attributable to anti-Kpa. One twin born to a woman whose serum 
contained anti-Kpa experienced HDFN while the other did not. 
Based on DNA analysis, the predicted blood type of the affected 
twin was Kp(a+b+) and that of the unaffected twin was Kp(a–b+). 
The laboratory findings and clinical course of the affected twin 
were consistent with suppression of erythropoiesis in addition 
to immune RBC destruction. Immunohematology 2011;27: 
58–60.
Key words: erythropoiesis—suppression, Kell blood 
group system, hemolytic disease of the newborn, Kpa 
The first antigen in the Kell blood group system, K, was 
discovered in 1946 as the result of hemolytic disease of the 
newborn. The system now includes 31 antigens. Antibodies 
to K, k, Kpa, Kpb, Kpc, Jsa, and Jsb are the most clinically 
important.1 Next to anti-A, anti-B, and anti-D, anti-K is 
the most common immune RBC antibody.2 Antibodies to 
antigens in the Kell blood group system are usually IgG, 
and, notoriously, anti-K, anti-k, and anti-Kpa cause severe 
hemolytic transfusion reactions, as well as severe hemolytic 
disease of the fetus and newborn (HDFN).3,4
It is well known that the titer of anti-K does not correlate 
with the severity of HDFN; indeed, severe HDFN caused 
by anti-K has been associated with lower antibody titers, 
bilirubin levels, and reticulocytosis than has hemolytic 
disease of the newborn caused by anti-D.2,3 The anemia 
seen in these infants is caused by a combination of immune 
destruction and suppression of erythropoiesis in the 
fetus.5,6 Vaughan et al. demonstrated experimentally that 
proliferation of K+ erythroid progenitors was inhibited by 
anti-K, and suggested that the K glycoprotein plays a role in 
erythropoiesis.5
Cases of HDFN involving antibodies to other antigens 
in the Kell system of antibodies are rare. We retrospectively 
report a case of HDFN in twins of a mother whose serum 
contained anti-Kpa. The Kp(a+) twin was anemic, and the 
Kp(a–) twin was not.
Case History
A 31-year-old gravida 3, para 2 woman with a history 
of a negative antibody screen delivered ABO-identical, Rh-
compatible fraternal twins at full term (37 weeks’ gestation). 
The mother had two previous pregnancies delivered by 
cesarean section; no problems were noted in the medical 
record. At delivery, the cord hemoglobin (Hb) for twin A 
(male) was 10.2 g/dL and for twin B (female) was 17.0 g/dL. 
Unfortunately, there were no cord bilirubin or reticulocyte 
counts done for either twin.
Because of anemia, shortly after birth twin A received 
a single-aliquot RBC transfusion that was compatible with 
the maternal serum. On day 1, he received an additional 
single-aliquot transfusion with RBCs and was discharged 
on day 5 with a Hb of 15.1 g/dL and an absolute reticulocyte 
count of 0.16 × 109/L (normal range of 0.125–0.325 × 
109/L). Transfusion was again required on day 25 when the 
Hb reached a nadir of 7.5 g/dL with a decreased absolute 
reticulocyte count of 0.007 m/μL. Additional transfusions 
were given on days 30 and 39 to maintain a Hb level above 
9.0 g/dL. After transfusion of two aliquots on day 39, the 
Hb of twin A was 9.6 g/dL and on day 43 and 52 it was 9.3 
g/dL and 9.5 g/dL, respectively. Two weeks later the Hb was 
10.3 g/dL, and 6 months later it was 12.6 g/dL. The infant’s 
bilirubin peaked at 5 mg/dL on day 1 and fell steadily during 
the monitoring period. White blood cell and platelet counts 
remained normal.
Materials and Methods
Hemagglutination
Standard hemagglutination tests were used throughout. 
The cord blood samples were tested by tube method for 
Possible suppression of fetal erythropoiesis by 
the Kell blood group antibody anti-Kpa
M. Tuson, K. Hue-Roye, K. Koval, S. Imlay, R. Desai, G. Garg, E. Kazem, D. Stockman, J. Hamilton, and M.E. Reid
Case RepoRt
IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 59
Suppression of fetal erythropoiesis by anti-Kpa
ABO, Rh, and direct antiglobulin test (DAT). The maternal 
and paternal samples were tested by MTS gel cards (Ortho 
Clinical Diagnostics, Raritan, NJ).
Polymerase Chain Reaction–Restriction Fragment 
Length Polymorphism Analysis for KEL*03/KEL*04
Genomic DNA was isolated from epithelial cells 
captured by the buccal swabs obtained from the twins 
using a DNA kit (QIAamp DNA Blood Mini Kit, QIAGEN, 
Inc., Valencia, CA). Exon 8 of KEL was amplified using 
a forward oligonucleotide primer (Life Technologies, 
Inc., Gaithersburg, MD) designed within exon 8 
(TACCTGACTTACCTGAATCAGCTGGGAACC) and a 
reverse oligonucleotide primer designed at the 3′ end of 
exon 8 and into intron 8 (tcttctggcccccagttccaggcacCATGA). 
Five microliters of DNA per reaction was amplified by 5 
units of Taq DNA polymerase (HotStarTaq, QIAGEN Inc., 
Valencia, CA) in a 50-μL reaction mixture containing 
2.5 mM MgCl2, 1 × PCR buffer, 0.2 mM dNTPs, and 100 
ng of forward and reverse primer. The PCR amplification 
was achieved in 35 cycles with a final extension time of 10 
minutes, using 62°C as the annealing temperature. The 
PCR 202-bp products were digested using the restriction 
enzyme NlaIII. A restriction enzyme site for this restriction 
enzyme is present in the KEL*03 variant (841T) but not in 
the wild-type (841C).
Results
Hemagglutination
At the time of delivery, anti-Kpa was identified in the 
maternal serum. No other unexpected antibodies were 
present in the maternal serum. Tests using the serum 
from twin A and an eluate prepared from his RBCs also 
contained anti-Kpa (Table 1). Antibody testing on days 25, 
30, and 39 demonstrated the persistence of anti-Kpa in the 
baby’s serum.
Polymerase Chain Reaction–Restriction Fragment 
Length Polymorphism Analysis for KEL*03/KEL*04
Twin A (boy) was KEL*841T/C (KEL*03/KEL*04), 
which is predicted to encode Kp(a+b+). Twin B (girl) was 
KEL*841C/C (KEL*04/KEL*04), which is predicted to 
encode Kp(a–b+).
Conclusions
We describe the first reported case of possible 
suppression of erythropoiesis attributable to anti-Kpa. One 
twin born to a woman whose serum contained anti-Kpa 
experienced HDFN and anemia, while the other did not. 
Based on DNA analysis, the predicted blood type of the 
affected twin was Kp(a+b+) and that of the unaffected twin 
was Kp(a–b+). The laboratory findings and clinical course 
of the affected twin were consistent with suppression of 
erythropoiesis in addition to immune RBC destruction. The 
steadily declining bilirubin levels concurrent with a declining 
hemoglobin level and decreased absolute reticulocyte 
count provide supportive evidence for this interpretation. 
It is possible that the change in the reticulocyte count was 
induced, or exacerbated, by transfusion. Although this was 
a retrospective study and not all data were available to us, it 
is worth documenting, especially because one twin was an 
antigen-negative twin and served as a control.
Antigens in the Kell blood group system appear on 
erythroid progenitor cells early in erythropoiesis.7,8 Because 
erythroid progenitor cells do not contain hemoglobin, 
immune destruction of these cells by anti-Kpa could 
explain the absence of hyperbilirubinemia in our patient. 
The restriction of Kell messenger RNA and protein to 
erythroid precursors explains why white blood cell and 
platelet counts remained normal in the affected twin.9,10 
The anemia of the affected twin resolved after 3 months, 
and his Hb has remained within the normal range. Twin B 
had no postdelivery complications and provides a biologic 
control for factors other than maternal alloantibody as a 
cause of the anemia. Although anti-K is most commonly 
associated with erythropoietic suppression, twin A shows 
that antibodies to other antigens in the Kell blood group 
system can also have this capability.
Acknowledgments
We thank Yaddanapudi Ravindranath, MD, for follow-
up information after the twins were discharged from 
the hospital and Robert Ratner for help in preparing the 
manuscript.
Table 1. Results of hemagglutination tests
Mother Twin A Twin B Father
ABO/Rh A + A + A + A +
DAT Not tested 4+ 0 Not tested
IAT with  
maternal serum
Not tested Not tested Compatible Incompatible
Other studies Anti-Kpa Anti-Kpa in 
serum and 
eluate
Kp(a+)
DNA from  
buccal smear
Not tested KEL*03/
KEL*04
KEL*04/
KEL*04
Not tested
DAT = direct antiglobulin test; IAT = indirect antiglobulin test.
60 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011
M. Tuson et al.
References
 1. Reid ME, Lomas-Francis C. Blood Group Antigens and 
Antibodies: A guide to clinical relevance and technical tips. 
New York, NY: Star Bright Books, 2007.
 2. Klein HG, Anstee DJ. Mollison’s blood transfusion in clinical 
medicine. 11th ed. Oxford: Wiley-Blackwell, 2006.
 3. Roback JD, Combs MR, Grossman BJ, et al. Technical 
manual. 16th ed. Bethesda, MD: American Association of 
Blood Banks, 2008.
 4. Costamagna L, Barbarini M, Viarengo GL, Pagani A, Isernia 
D, Salvaneschi L. A case of hemolytic disease of the newborn 
due to anti-Kpa. Immunohematology 1997;13:61–2.
 5. Vaughan JI, Manning M, Warwick RM, Letsky EA, Murray 
NA, Roberts IA. Inhibition of erythroid progenitor cells by 
anti-Kell antibodies in fetal alloimmune anemia. N Engl J 
Med 1998;338:798–803.
 6. Daniels G, Hadley A, Green CA. Causes of fetal anemia in 
hemolytic disease due to anti-K. Transfusion 2003;43:115–
16.
 7. Southcott MJG, Tanner MJ, Anstee DJ. The expression of 
human blood group antigens during erythropoiesis in a cell 
culture system. Blood 1999;93:4425–35.
 8. Daniels G, Green C. Expression of red cell surface antigens 
during erythropoiesis. Vox Sang 2000;78(Suppl 2):149–53.
 9. Jaber A, Loirat MJ, Willem C, Bloy C, Cartron JP, Blanchard 
D. Characterization of murine monoclonal antibodies 
directed against the Kell blood group glycoprotein. Br J 
Haematol 1991;79:311–15.
 10. McGinniss MH, Dean A. Expression of red cell antigens by 
K562 human leukemia cells before and after induction of 
hemoglobin synthesis by hemin. Transfusion 1985;25:105–
9.
Michelle Tuson, MT(ASCP)SBB, Trinity Health, Farmington Hills, 
MI; Kim Hue-Roye, BSc, Laboratory of Immunochemistry, New 
York Blood Center, New York, NY; Karen Koval, MT, Sherwin 
Imlay, MD, Rajendra Desai, MD, Gayatri Garg, MD, and Esam 
Kazem, MD, St. Joseph Mercy Hospital—Oakland, Pontiac, MI; 
Diane Stockman, MT(ASCP), and Janis S. Hamilton, MT(ASCP)
SBB, American Red Cross, Southeastern Michigan Region, 
Detroit, MI; and Marion E. Reid, PhD (corresponding author), 
Laboratory of Immunochemistry, New York Blood Center, 310 
East 67th Street, New York, NY 10065.
Attention:  
State Blood Bank Meeting Organizers
If you are planning a state meeting and would like copies 
of Immunohematology for distribution, please send request, 
4 months in advance, to immuno@usa.redcross.org
Notice to Readers
All articles published, including communications and book 
reviews, reflect the opinions of the authors and do not 
necessarily reflect the official policy of the American Red 
Cross.
For information concerning the National Reference 
Laboratory for Blood Group Serology, including the American 
Rare Donor Program, contact Sandra Nance, by phone at 
(215) 451-4362, by fax at (215) 451-2538, or by e-mail at 
snance@usa.redcross.org
Attention: SBB and BB Students
You are eligible for a free 1-year subscription to 
Immunohematology.
Ask your education supervisor to submit the name and 
complete address for each student and the inclusive dates 
of the training period to immuno@usa.redcross.org


Possible suppression of fetal erythropoiesis by the Kell blood group antibody anti-Kpa

Not a member yet

A modified PCR-RFLP genotyping method demonstrates the presence of the HPA-4b platelet alloantigen in a North American Indian population

Delayed hemolytic transfusion reaction and paroxysmal cold hemoglobinuria: an unusual association

Case report: reporting anti-G as anti-C+D may have misleading clinical implications

Common variable immunodeficiency: diagnosis by absent ABO reverse type

Comparison of hemagglutination and solid phase titration methods for determination of critical prenatal antibody titers

Anti-Jk3 with no clinical evidence of HDN

Letters to the Editors: "Those Were the Days"

Performance characteristics of two automated solid-phase red cell adherence systems for pretransfusion antibody screening:  a cautionary tale

Erratum Vol. 26, No. 4, 2010, p. 164

Possible suppression of fetal erythropoiesis by the Kell blood group antibody anti-Kpa

4,746

6,096